N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction
by

1 Answer

Answer :

Answer : A
by
selected

Related questions

All α-amino acids give positive (A) Million’s test (B) Biurete test (C) Xanthproteic test (D) Ninhydrine test

Description : All α-amino acids give positive (A) Million’s test (B) Biurete test (C) Xanthproteic test (D) Ninhydrine test

Last Answer : Answer : D

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Sanger’s reagent contains (A) Phenylisothiocyanate (B) Dansyl chloride (C) 1-Fluoro-2, 4-dinitrobenzene (D) Ninhydrin

Description : Sanger’s reagent contains (A) Phenylisothiocyanate (B) Dansyl chloride (C) 1-Fluoro-2, 4-dinitrobenzene (D) Ninhydrin

Last Answer : Answer : C

Primary structure of proteins can be determined by the use of (A) Electrophoresis (B) Chromatography (C) Ninhydrin (D) Sanger’s reagent

Description : Primary structure of proteins can be determined by the use of (A) Electrophoresis (B) Chromatography (C) Ninhydrin (D) Sanger’s reagent

Last Answer : Answer : D

Glycoproteins are marked for destruction by removal of their (A) Oligosaccharide prosthetic group (B) Sialic acid residues (C) Mannose residues (D) N-terminal amino acids

Description : Glycoproteins are marked for destruction by removal of their (A) Oligosaccharide prosthetic group (B) Sialic acid residues (C) Mannose residues (D) N-terminal amino acids

Last Answer : Answer : D

Biological activity of gastrin is present in the (A) Four N-terminal amino acids (B) Four C-terminal amino acids (C) Five N-terminal amino acids (D) Five C-terminal amino acids

Description : Biological activity of gastrin is present in the (A) Four N-terminal amino acids (B) Four C-terminal amino acids (C) Five N-terminal amino acids (D) Five C-terminal amino acids

Last Answer : Answer : B

Amino acid residues which are essential for the biological activity of PTH are (A) N-terminal 34 amino acids (B) N-terminal 50 amino acids (C) C-terminal 34 amino acids (D) C-terminal 50 amino acids

Description : Amino acid residues which are essential for the biological activity of PTH are (A) N-terminal 34 amino acids (B) N-terminal 50 amino acids (C) C-terminal 34 amino acids (D) C-terminal 50 amino acids

Last Answer : Answer : A

Bence-Jones proteins possess all the following properties except (A) They are dimers of light chains (B) Their amino acids sequences are identical (C) Their N-terminal halves have variable amino acid sequences (D) Their C-terminal halves have constant amino acid sequences

Description : Bence-Jones proteins possess all the following properties except (A) They are dimers of light chains (B) Their amino acids sequences are identical (C) Their N-terminal halves have variable amino acid sequences (D) Their C-terminal halves have constant amino acid sequences

Last Answer : Answer : B

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

The useful reagent for detection of amino acids is (A) Molisch reagent (B) Dichlorophenol Indophenol (C) Ninhydrin (D) Biuret

Description : The useful reagent for detection of amino acids is (A) Molisch reagent (B) Dichlorophenol Indophenol (C) Ninhydrin (D) Biuret

Last Answer : Answer : C

When amino acids are treated with neutral formaldehyde, the pH of the mixture (A) Is not altered (B) Increases (C) Decreases (D) First increases then decreases

Description : When amino acids are treated with neutral formaldehyde, the pH of the mixture (A) Is not altered (B) Increases (C) Decreases (D) First increases then decreases

Last Answer : Answer : C

The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges in the protein (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Description : Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges ... (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Last Answer : reducing the disulfide bridges in the protein

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Hormonal activity of ACTH is completely lost on removal of (A) 5 C-terminal amino acids (B) 10 C-terminal amino acids (C) 15 C-terminal amino acids (D) None of these

Description : Hormonal activity of ACTH is completely lost on removal of (A) 5 C-terminal amino acids (B) 10 C-terminal amino acids (C) 15 C-terminal amino acids (D) None of these

Last Answer : Answer : D

Base sequence of DNA can be determined by (A) Maxam-Gilbert method (B) Sanger’s dideoxy method (C) Both (A) and (B) (D) None of these

Description : Base sequence of DNA can be determined by (A) Maxam-Gilbert method (B) Sanger’s dideoxy method (C) Both (A) and (B) (D) None of these

Last Answer : Answer : C

In sanger’s method of DNA sequence determination, DNA synthesis is stopped by using (A) 1′, 2′- Dideoxyribonucleoside triphosphates (B) 2′, 3′- Dideoxyribonucleoside triphosphates (C) 2′, 4′- Dideoxyribonucleoside triphosphates (D) 2′, 5′ - Dideoxyribonucleoside triphosphates

Description : In sanger’s method of DNA sequence determination, DNA synthesis is stopped by using (A) 1′, 2′- Dideoxyribonucleoside triphosphates (B) 2′, 3′- Dideoxyribonucleoside triphosphates (C) 2′, 4′- Dideoxyribonucleoside triphosphates (D) 2′, 5′ - Dideoxyribonucleoside triphosphates

Last Answer : Answer : B

Biological activity of ACTH requires (A) 10-N-terminal amino acid (B) 24-N-terminal amino acid (C) 24-C-terminal amino acid (D) 15-C-terminal amino acid

Description : Biological activity of ACTH requires (A) 10-N-terminal amino acid (B) 24-N-terminal amino acid (C) 24-C-terminal amino acid (D) 15-C-terminal amino acid

Last Answer : Answer : B

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

What are the Reaction of amino acid using ninhydrin and biuret reagent?

Description : What are the Reaction of amino acid using ninhydrin and biuret reagent?

Last Answer : What is the answer ?

Which of the following gives a positive Ninhydrin test? (A) Reducing sugar (B) Triglycerides (C) α-amino acids (D) Phospholipids

Description : Which of the following gives a positive Ninhydrin test? (A) Reducing sugar (B) Triglycerides (C) α-amino acids (D) Phospholipids

Last Answer : Answer : C

Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids

Description : Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids

Last Answer : Answer : C

Will amino acids give a positive biuret test?

Description : Will amino acids give a positive biuret test?

Last Answer : No. This needs a minimum of two peptide bonds.

Aromatic amino acids can be detected by (A) Sakaguchi reaction (B) Millon-Nasse reaction (C) Hopkins-Cole reaction (D) Xanthoproteic reaction

Description : Aromatic amino acids can be detected by (A) Sakaguchi reaction (B) Millon-Nasse reaction (C) Hopkins-Cole reaction (D) Xanthoproteic reaction

Last Answer : Answer : D

At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

The figure shows a hypothetical tetrapeptide portion of a protein with parts labelled A-D. Which one of the following options is correct? – HN – CH – CO – NH – CH – CO – NH – CH – CO – HN – CH – CO – CH2 OH CH2 SH CH2 OH CH2 CH2 CH2– COOH A B C D (a) D is the acidic amino acid-glutamic acid. (b) C is an aromatic amino acid-tryptophan. (c) A is the C-terminal amino acid and D is N-terminal amino acid. (d) A is a sulphur containing amino acid methionine.

Description : The figure shows a hypothetical tetrapeptide portion of a protein with parts labelled A-D. Which one of the following options is correct? - HN - CH - CO - NH - CH - CO - NH - CH - CO - ... -terminal amino acid and D is N-terminal amino acid. (d) A is a sulphur containing amino acid methionine.

Last Answer : (a) D is the acidic amino acid-glutamic acid.

Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Description : Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Last Answer : Answer : B

Alcoholic OH) group can be identified by : (1) Tolien's Reagent Test (2) Esterification Test (3) FeCl3 Test (4) Ozonolysis Reaction

Description : Alcoholic OH) group can be identified by : (1) Tolien's Reagent Test (2) Esterification Test (3) FeCl3 Test (4) Ozonolysis Reaction

Last Answer : (3) FeCl3 Test Explanation: As phenol is an aromatic alcohol, so FeCl3 test is a test for alcohol and esterificaton test is also a test for alcohol. The ferric chloride test is used to determine the presence or absence of phenols in a given sample (for instance natural phenols in a plant extract).

Alcoholic (– OH) group can be identified by : (1) Tollen's Reagent Test (2) Esterification Test (3) FeCl3 Test (4) Ozonolysis Reaction

Description : Alcoholic (– OH) group can be identified by : (1) Tollen's Reagent Test (2) Esterification Test (3) FeCl3 Test (4) Ozonolysis Reaction

Last Answer : FeCl3 Test

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

Guanidine group of argentine gives positive test with (A) Lead acetate (B) Sakaguchi reagent (C) Tricholoroacetic acid (D) Molisch’s reagent

Description : Guanidine group of argentine gives positive test with (A) Lead acetate (B) Sakaguchi reagent (C) Tricholoroacetic acid (D) Molisch’s reagent

Last Answer : Answer : B

Indole group of tryptophan responses positively to (A) Glyoxylic acid (B) Schiff’s reagent (C) Biuret test (D) Resorcinol test

Description : Indole group of tryptophan responses positively to (A) Glyoxylic acid (B) Schiff’s reagent (C) Biuret test (D) Resorcinol test

Last Answer : Answer : A

Cation exchange resins used in water treatment is made from __________ resin. (A) Urea formaldehyde (B) Epoxy (C) Amino (D) Phenolic

Description : Cation exchange resins used in water treatment is made from __________ resin. (A) Urea formaldehyde (B) Epoxy (C) Amino (D) Phenolic

Last Answer : (A) Urea formaldehyde

__________ resins are produced by the condensation polymerisation of formaldehyde with urea or melamine. (A) Epoxy (B) Amino (C) Alkyd (D) Phenolic

Description : __________ resins are produced by the condensation polymerisation of formaldehyde with urea or melamine. (A) Epoxy (B) Amino (C) Alkyd (D) Phenolic

Last Answer : (B) Amino