CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
by

1 Answer

Answer :

Answer :  B
by
selected

Related questions

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84

Description : Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84

Last Answer : Answer : A

The number of amino acid residues in PTH: (A) 51 (B) 84 (C) 90 (D) 115

Description : The number of amino acid residues in PTH: (A) 51 (B) 84 (C) 90 (D) 115

Last Answer : Answer : B

Number of amino acid residues in prolactin is (A) 51 (B) 84 (C) 191 (D) 198

Description : Number of amino acid residues in prolactin is (A) 51 (B) 84 (C) 191 (D) 198

Last Answer : Answer : D

Number of amino acid residues in human growth hormone is (A) 51 (B) 84 (C) 191 (D) 198

Description : Number of amino acid residues in human growth hormone is (A) 51 (B) 84 (C) 191 (D) 198

Last Answer : Answer : C

The number of amino acid residues in preproinsulin is (A) 51 (B) 84 (C) 109 (D) 119

Description : The number of amino acid residues in preproinsulin is (A) 51 (B) 84 (C) 109 (D) 119

Last Answer : Answer : C

The number of amino acid residues in calcitonin in (A) 9 (B) 32 (C) 51 (D) 84

Description : The number of amino acid residues in calcitonin in (A) 9 (B) 32 (C) 51 (D) 84

Last Answer : Answer : B

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

The number of amino acids in parathormone is (A) 65 (B) 84 (C) 115 (D) 122

Description : The number of amino acids in parathormone is (A) 65 (B) 84 (C) 115 (D) 122

Last Answer : Answer : B

The number of amino acids in pre-pro insulin is (A) 51 (B) 86 (C) 109 (D) 132

Description : The number of amino acids in pre-pro insulin is (A) 51 (B) 86 (C) 109 (D) 132

Last Answer : Answer : C

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Regulation of ACTH secretion occurs through (A) Corticotropin releasing hormone (CRH) and corticotropin release inhibiting hormone (CRIH) of hypothalamus (B) Feedback inhibition by cortisol (C) CRH and feedback inhibition by cortisol (D) CRIH and feedback inhibition by cortisol

Description : Regulation of ACTH secretion occurs through (A) Corticotropin releasing hormone (CRH) and corticotropin release inhibiting hormone (CRIH) of hypothalamus (B) Feedback inhibition by cortisol (C) CRH and feedback inhibition by cortisol (D) CRIH and feedback inhibition by cortisol

Last Answer : Answer : C

Each gm of protein on complete oxidation yields (A) 0.21 gm water (B) 0.31 gm water (C) 0.41 gm water (D) 0.51 gm water

Description : Each gm of protein on complete oxidation yields (A) 0.21 gm water (B) 0.31 gm water (C) 0.41 gm water (D) 0.51 gm water

Last Answer : Answer : C

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

During which decade did the population record a negative growth rate? (a) 1921-31 (b) 1911-21 (c) 1941-51 (d) 1931-41

Description : During which decade did the population record a negative growth rate? (a) 1921-31 (b) 1911-21 (c) 1941-51 (d) 1931-41

Last Answer : Ans: (b)

During which decade did the population of India record a negative growth rate? (1) 1921-31 (2) 1911-21 (3) 1941-51 (4) 1931-41

Description : During which decade did the population of India record a negative growth rate? (1) 1921-31 (2) 1911-21 (3) 1941-51 (4) 1931-41

Last Answer : (2) 1911-21 Explanation: Negative Population growth rate or decline in population can refer to the decline in population of humans. It is a term usually used to describe any great reduction in a ... famines accounted for this decline. Plague epidemic in 1918 took a toll of 140 lakh human lives.

The holder (an adult and not a minor) of a certificate who desire to make a nomination will apply in a) NC 36 b) NC 51 c) NC 10 d) NC 41

Description : The holder (an adult and not a minor) of a certificate who desire to make a  nomination will apply in a) NC 36 b) NC 51 c) NC 10 d) NC 41

Last Answer : b) NC 51

The holder (an adult and not a minor) of a certificate who desire to make a nomination will apply in a) NC 36 b) NC 51 c) NC 10 d) NC 41

Description : The holder (an adult and not a minor) of a certificate who desire to make a  nomination will apply in a) NC 36 b) NC 51 c) NC 10 d) NC 41

Last Answer : b) NC 51

An asset of Rs.85,000 was purchased for Rs.75,000 and was recorded in the books at Rs.85,000. What is the correct amount of profit to be reported in the books? a) Rs.1,47,000 b) Rs. 1,51,000 c) Rs.1,63,000 d) Rs.1,41,000

Description : An asset of Rs.85,000 was purchased for Rs.75,000 and was recorded in the books at Rs.85,000. What is the correct amount of profit to be reported in the books? a) Rs.1,47,000 b) Rs. 1,51,000 c) Rs.1,63,000 d) Rs.1,41,000

Last Answer : b) Rs. 1,51,000

The minimum and maximum clearances of check rails at all BG level crossings shall be a) 51 to 57 mm* b) 44 to 48 mm c) 41 to 45 mm d) 55 to 70 mm

Description : The minimum and maximum clearances of check rails at all BG level crossings shall be a) 51 to 57 mm* b) 44 to 48 mm c) 41 to 45 mm d) 55 to 70 mm

Last Answer : a) 51 to 57 mm*

Nesha scored 120 out of 150 in English, 120 out of 180 in mathematics and 160 out of 200 in Science. Find Nesha’s score as percentage: (i) in Mathematics (ii) in all the three subjects (on the whole). a) 66 2/3, 78 22/51 b) 71 23/5, 45 7/31 c) 54 13/33, 82 3/4 d) 60 3/4, 76 32/41

Description : Nesha scored 120 out of 150 in English, 120 out of 180 in mathematics and 160 out of 200 in Science. Find Nesha’s score as percentage: (i) in Mathematics (ii) in all the three subjects (on the whole). a) 66 2/3, 78 22/51 b) 71 23/5, 45 7/31 c) 54 13/33, 82 3/4 d) 60 3/4, 76 32/41 

Last Answer :  Answer: A (i) Percentage scored in Mathematics = 120/180 100  = 12000/180  =1200/18  = 66 2 /3 % (ii) Total maximum of all the three subjects = 150 + 160 + 200 = 510 and Total score in the ... percentage on the whole = (400/510 100)  = (40000/510)  = 4000/51  = 78 22/51 %

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Description : 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Last Answer : 22

Maria, Ivan, Leah, Julie, and Scott measured each other’s heights for health class The heights are 42 39 41, 37 and 39 inches Julie is 2 inches shorter than Leah Maria is 1 inch shorter than Scott and 2 inches taller than Leah How tall is each student?

Description : Maria, Ivan, Leah, Julie, and Scott measured each other’s heights for health class The heights are 42 39 41, 37 and 39 inches Julie is 2 inches shorter than Leah Maria is 1 inch shorter than Scott and 2 inches taller than Leah How tall is each student?

Last Answer : it is 5th grade math

Three telephone circuits, each having an S/N ratio of 44 dB, are connected in tandem. What is the overall S/N ratio? A. 44 dB B. 39.2 dB C. 41 dB D. 43.52 dB

Description : Three telephone circuits, each having an S/N ratio of 44 dB, are connected in tandem. What is the overall S/N ratio? A. 44 dB B. 39.2 dB C. 41 dB D. 43.52 dB

Last Answer : B. 39.2 dB

The staff reading at a distance of 80 m from a level with the bubble at its centre is 1.31 m. When the bubble is moved by 5 divisions out of the centre, the reading is 1.39 m. The angular value of the one division of the bubble, is (A) 28.8 sec (B) 41.25 sec (C) 14.52 sec (D) 25.05

Description : The staff reading at a distance of 80 m from a level with the bubble at its centre is 1.31 m. When the bubble is moved by 5 divisions out of the centre, the reading is 1.39 m. The angular value of the one division of the bubble, is (A) 28.8 sec (B) 41.25 sec (C) 14.52 sec (D) 25.05

Last Answer : (B) 41.25 sec

Ravi borrowed some money at the rate of 4 p.c.p.a. for the first three years, at the rate of 8 p.c.p.a. for the next two years and at the rate of 9 p.c.p.a. for the period beyond 5 years. If he pays a total simple interest of 19,550 at the end of 7 years, how much money did he borrow? a) 39,500 b) 42,500 c) 41,900 d) 43,000 e) None of these

Description : Ravi borrowed some money at the rate of 4 p.c.p.a. for the first three years, at the rate of 8 p.c.p.a. for the next two years and at the rate of 9 p.c.p.a. for the period beyond 5 years. If he pays a ... 7 years, how much money did he borrow? a) 39,500 b) 42,500 c) 41,900 d) 43,000 e) None of these

Last Answer : Let the amount borrowed be Rs P Total amount of simple interest = (P×3×4)/100 + (p×2×8)/100 + (p×2×9)/100 = 19550 0.12P + 0.16P + 0.18P = 19550 0.46p= 19550 P = Rs. 42500 Answer: b)

At what height must top rails be fitted above working platform? a. Between 90 cm (35 inches) and 110 cm (43 inches) b. Between 100 cm (39 inches) and 120 cm (47 inches) c. Between 95 cm (38 inches) and 115 cm ( 45 inches) d. Between 105 cm (41 inches)and 125 cm (49 inches)

Description : At what height must top rails be fitted above working platform? a. Between 90 cm (35 inches) and 110 cm (43 inches) b. Between 100 cm (39 inches) and 120 cm (47 inches) c. Between 95 cm (38 inches) and 115 cm ( 45 inches) d. Between 105 cm (41 inches)and 125 cm (49 inches)

Last Answer : c. Between 95 cm (38 inches) and 115 cm ( 45 inches)

The sequence of amino acid in which the biological value of parathormone is (A) 1–15 (B) 1–34 (C) 30–50 (D) 50–84

Description : The sequence of amino acid in which the biological value of parathormone is (A) 1–15 (B) 1–34 (C) 30–50 (D) 50–84

Last Answer : Answer : B

The median of the data 78, 56, 22, 34, 45, 54, 39, 68, 54 and 84 is -Maths 9th

Description : The median of the data 78, 56, 22, 34, 45, 54, 39, 68, 54 and 84 is -Maths 9th

Last Answer : NEED ANSWER

The median of the data 78, 56, 22, 34, 45, 54, 39, 68, 54 and 84 is -Maths 9th

Description : The median of the data 78, 56, 22, 34, 45, 54, 39, 68, 54 and 84 is -Maths 9th

Last Answer : According to question find the median of the data

At 60° C, vapour pressure of methanol and water are 84.562 kPa and 19.953 kPa respectively. An aqueous solution of methanol at 60° C exerts a pressure of 39.223 kPa; the liquid phase and vapour phase mole fractions of methanol are 0.1686 and 0.5714 respectively. Activity co-efficient of methanol is (A) 1.572 (B) 1.9398 (C) 3.389

Description : At 60° C, vapour pressure of methanol and water are 84.562 kPa and 19.953 kPa respectively. An aqueous solution of methanol at 60° C exerts a pressure of 39.223 kPa; the liquid phase and vapour phase mole ... respectively. Activity co-efficient of methanol is (A) 1.572 (B) 1.9398 (C) 3.389

Last Answer : (A) 1.572

What is 35.78 plus 39.51?

Description : What is 35.78 plus 39.51?

Last Answer : 75.29 - 39.51 = 35.78

What is 39.51 to the nearest whole second?

Description : What is 39.51 to the nearest whole second?

Last Answer : The answer depends on the units used for 39.51: It should beblindingly obvious to anybody that the answer for 39.51 hours and39.51 milliseconds will be very different.

Which of the following Articles of the Constitution deals with the Fundamental Duties? (1) Article 39 C (2) Article 51 A (3) Article 29 B (4) None of the above

Description : Which of the following Articles of the Constitution deals with the Fundamental Duties? (1) Article 39 C (2) Article 51 A (3) Article 29 B (4) None of the above

Last Answer : (2) Article 51 A Explanation: The Forty-second Amendment of the Constitution of India, enacted in 1976, laid down the Fundamental Duties of Indian citizens to the nation. The amendment inserted ... new part called IV-A in the Constitution, which prescribed the fundamental duties to the citizens.