Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids
by

1 Answer

Answer :

Answer :  C
by
selected

Related questions

Biological activity of gastrin is present in the (A) Four N-terminal amino acids (B) Four C-terminal amino acids (C) Five N-terminal amino acids (D) Five C-terminal amino acids

Description : Biological activity of gastrin is present in the (A) Four N-terminal amino acids (B) Four C-terminal amino acids (C) Five N-terminal amino acids (D) Five C-terminal amino acids

Last Answer : Answer : B

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

There was only enough fuel in the last tank to fly a) For six to twelve minutes. b) For ten to twelve minutes.c) For fifteen to twenty minutes. d) For five to ten minutes

Description : There was only enough fuel in the last tank to fly a) For six to twelve minutes. b) For ten to twelve minutes.c) For fifteen to twenty minutes. d) For five to ten minutes

Last Answer : d) For five to ten minutes

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

How many minutes from twenty to twelve until half past 12?

Description : How many minutes from twenty to twelve until half past 12?

Last Answer : 50 minutes in total.

How many minutes from twenty to twelve until half past 122?

Description : How many minutes from twenty to twelve until half past 122?

Last Answer : The answer depends on what you intended by "half past 122".

How many Fundamental Duties are in the Indian Constitution? (1) Eleven (2) Nine (3) (4) Twelve (4) (3) Twenty

Description : How many Fundamental Duties are in the Indian Constitution? (1) Eleven (2) Nine (3) (4) Twelve (4) (3) Twenty

Last Answer : (1) Eleven Explanation: Originally ten in number, the Fundamental Duties were increased to eleven by the 86th Amendment in 2002, which added a duty on every parent or guardian to ensure that their child or ward was provided opportunities for education between the ages of six and fourteen years.

A document is said to be in handwriting of A that the document is produced from proper custody, If the document is purporting or proved to be years old the court may presume that is in A’s handwriting a) Thirty b) Fifteen c) Twenty d) Twelve

Description : A document is said to be in handwriting of A that the document is produced from  proper custody, If the document is purporting or proved to be years old the court may  presume that is in A’s handwriting a) Thirty b) Fifteen c) Twenty d) Twelve

Last Answer : a) Thirty

How many 2 cent stamps are in a dozen? Six Twelve Eighteen Twenty-four

Description : How many 2 cent stamps are in a dozen? Six Twelve Eighteen Twenty-four

Last Answer : Twelve

A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Description : A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Last Answer : Answer : A

The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Description : The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Last Answer : Answer : B

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland (C) It is the precursor of ACTH and melatonin (D) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Description : All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland ... ) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Secretin is made up of (A) 17 amino acids (B) 27 amino acids (C) 37 amino acids (D) 47 amino acids

Description : Secretin is made up of (A) 17 amino acids (B) 27 amino acids (C) 37 amino acids (D) 47 amino acids

Last Answer : Answer : B

Glutathione is made up of which amino acids?

Description : Glutathione is made up of which amino acids?

Last Answer : Glutamic acid, cysteine and glycine.

Branching occurs in glycogen approximately after every (A) Five glucose units (B) Ten glucose units (C) Fifteen glucose units (D) Twenty glucose units

Description : Branching occurs in glycogen approximately after every (A) Five glucose units (B) Ten glucose units (C) Fifteen glucose units (D) Twenty glucose units

Last Answer : B

Sulphur is made available to the body by the amino acids: (A) Cystine and methionine (B) Taurine and alanine (C) Proline and hydroxyproline (D) Arginine and lysine MINERAL METABOLISM 191

Description : Sulphur is made available to the body by the amino acids: (A) Cystine and methionine (B) Taurine and alanine (C) Proline and hydroxyproline (D) Arginine and lysine MINERAL METABOLISM 191

Last Answer : Answer : A

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

Gastric Secretion is regulated by the hormone: (A) Glucagon (B) Gastrin (C) Epinephrin (D) ACTH

Description : Gastric Secretion is regulated by the hormone: (A) Glucagon (B) Gastrin (C) Epinephrin (D) ACTH

Last Answer : Answer : B

Which of one of the following is not GUT hormone? (A) Motiline (B) Secretion (C) Gastrin (D) Calcitonin

Description : Which of one of the following is not GUT hormone? (A) Motiline (B) Secretion (C) Gastrin (D) Calcitonin

Last Answer : Answer : D

Inositol triphosphate is the second messenger for (A) Gastrin (B) Cholecystokinin (C) Oxytocin (D) All of these

Description : Inositol triphosphate is the second messenger for (A) Gastrin (B) Cholecystokinin (C) Oxytocin (D) All of these

Last Answer : Answer : D

Hormone that bind to cell surface receptor and require the second messenger camp is (A) Antidiuretic hormone (B) Cholecystokinin (C) Calcitriol (D) Gastrin

Description : Hormone that bind to cell surface receptor and require the second messenger camp is (A) Antidiuretic hormone (B) Cholecystokinin (C) Calcitriol (D) Gastrin

Last Answer : Answer : A

All of the following statements about pancreatic somatostain are true except (A) It is secreted by δ cells of islets of Langerhans (B) It stimulates the secretion of gastrin (C) It inhibits the secretion of secretin (D) It inhibits the secretion of cholecystokininpancreozymin

Description : All of the following statements about pancreatic somatostain are true except (A) It is secreted by δ cells of islets of Langerhans (B) It stimulates the secretion of gastrin (C) It inhibits the secretion of secretin (D) It inhibits the secretion of cholecystokininpancreozymin

Last Answer : Answer : B

Gastrin stimulates (A) Gastric motility (B) Gastric secretion (C) Both (A) and (B) (D) None of these

Description : Gastrin stimulates (A) Gastric motility (B) Gastric secretion (C) Both (A) and (B) (D) None of these

Last Answer : Answer : C

Secretion of gastrin is evoked by (A) Entry of food into stomach (B) Vagal stimulation (C) Lower aliphatic alcohols (D) All of these

Description : Secretion of gastrin is evoked by (A) Entry of food into stomach (B) Vagal stimulation (C) Lower aliphatic alcohols (D) All of these

Last Answer : Answer : D

Pentagastrin is a (A) Naturally occurring form of gastrin (B) Inactive metabolite of gastrin (C) Active metabolite of gastrin (D) Synthetic form of gastrin

Description : Pentagastrin is a (A) Naturally occurring form of gastrin (B) Inactive metabolite of gastrin (C) Active metabolite of gastrin (D) Synthetic form of gastrin

Last Answer : Answer : D

The unwanted amino acids abstracted from the tissues are either used up by the tissue or in the liver converted into (A) Ammonia (B) Urea (C) Ammonium salts (D) Uric acid

Description : The unwanted amino acids abstracted from the tissues are either used up by the tissue or in the liver converted into (A) Ammonia (B) Urea (C) Ammonium salts (D) Uric acid

Last Answer : Answer : B

A man wanted to enter an exclusive club but did not know the password that was required. He waited by the door and listened. A club member knocked on the door and the doorman said, 'twelve.' The member replied, 'six ' and was let in. A second member came to the door and the doorman said, 'six.' The member replied, 'three' and was let in. The man thought he had heard enough and walked up to the door. The doorman said ,'ten' and the man replied, 'five.' But he was not let in. What should have he said? -Riddles

Description : A man wanted to enter an exclusive club but did not know the password that was required. He waited by the door and listened. A club member knocked on the door and the doorman said, 'twelve.' The member ... and the man replied, 'five.' But he was not let in. What should have he said? -Riddles

Last Answer : Three. The doorman lets in those who answer with the number of letters in the word the doorman says.

A man wanted to enter an exclusive club but did not know the password that was required. He waited by the door and listened. A club member knocked on the door and the doorman said, "twelve." The member replied, "six" and was let in. A second member came to the door and the doorman said, "six." The member replied, "three" and was let in. The man thought he had heard enough and walked up to the door. The doorman said, "ten" and the man replied, "five". But he was not let in. What should have he said?

Description : A man wanted to enter an exclusive club but did not know the password that was required. He waited by the door and listened. A club member knocked on the door and the doorman said, "twelve." The member replied, ... "ten" and the man replied, "five". But he was not let in. What should have he said?

Last Answer : The man had to reply the number of characters in the word the Doorman was asking. He should have replied "Three" instead of "Five".

A man wanted to enter an exclusive club but did not know the password that was required. He waited by the door and listened. A club member knocked on the door and the doorman said, "twelve." The member replied, "six" and was let in. A second member came to the door and the doorman said, "six." The member replied, "three" and was let in. The man thought he had heard enough and walked up to the door. The doorman said, "ten" and the man replied, "five". But he was not let in. What should have he said?

Description : A man wanted to enter an exclusive club but did not know the password that was required. He waited by the door and listened. A club member knocked on the door and the doorman said, "twelve." The member replied, ... "ten" and the man replied, "five". But he was not let in. What should have he said?

Last Answer : The man had to reply the number of characters in the word the Doorman was asking. He should have replied "Three" instead of "Five".

If a girl who was sexually assaulted two or three months ago the guy was in his fifties the girl was seventeen and still is seventeen and there were two other people in the room that heard it can the guy still get in trouble?

Description : If a girl who was sexually assaulted two or three months ago the guy was in his fifties the girl was seventeen and still is seventeen and there were two other people in the room that heard it can the guy still get in trouble?

Last Answer : Yes, absolutely. The statute of limitations for sexual assault of a minor is 10 years in Iowa: https://apps.rainn.org/policy/policy-crime-definitions.cfm?state=Iowa&group=7 I’m so sorry this happened. Please let us know if we can help you figure out your next steps.