Description : In E. coli the chain initiating amino acid in protein synthesis is (A) N-formyl methionine(B) Methionine (C) Serine (D) Cysteine
Last Answer : Answer : A
Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine
Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine
Last Answer : Answer : B
Description : A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, ... L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine
Last Answer : C.proteins are synthesized from
Description : A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine
Last Answer : .proteins are synthesized from D-, rather than L-, isomers of amino acids
Description : An amino acid having a hydrophilic side chain is (A) Alanine (B) Proline (C) Methionine (D) Serine
Last Answer : Answer : D
Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds
Description : The sulphur containing amino acid: (A) Homoserine (B) Serine (C) Methionine (D) Valine
Last Answer : Answer : C
Description : An essential amino acid in man is (A) Aspartate (B) Tyrosine (C) Methionine (D) Serine
Description : The metabolic reaction requiring vitamin B12 but not folate is: A. Conversion of malonic acid to succinic acid B. Conversion of homocysteine to methionine C. Conversion of serine to glycine D. Thymidylate synthesis
Last Answer : A. Conversion of malonic acid to succinic acid
Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction
Description : The figure shows a hypothetical tetrapeptide portion of a protein with parts labelled A-D. Which one of the following options is correct? - HN - CH - CO - NH - CH - CO - NH - CH - CO - ... -terminal amino acid and D is N-terminal amino acid. (d) A is a sulphur containing amino acid methionine.
Last Answer : (a) D is the acidic amino acid-glutamic acid.
Description : An amino acid required for porphyrin synthesis is (A) Proline (B) Glycine (C) Serine (D) Histidine
Description : The amino acid from which synthesis of the protein of hair keratin takes place is (A) Alanine (B) Methionine (C) Proline (D) Hydroxyproline
Description : In A chain of the insulin molecule the Nterminal amino acid is (A) Glycine (B) Valine (C) Serine (D) Phenylalanine
Description : The amino acid with a nonpolar side chain is (A) Serine (B) Valine (C) Asparagine (D) Threonine
Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains
Description : Vitamin K is a cofactor for (A) Gamma carboxylation of glutamic acid residue (B) β-Oxidation of fatty acid (C) Formation of γ-amino butyrate (D) Synthesis of tryptophan
Description : The side chain of which of the following amino acid contain sulphur atom? (A) Methionine (B) Threonine (C) Leucine (D) Tryptophan
Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
Description : Both folic acid and methyl cobalamin (vitamin B12) are required in (A) Deamination of serine (B) Deamination of threonine (C) Conversion of pyridoxal phosphate to pyridoxamine phosphate (D) Methylation of homocystein to methionine
Description : I-cell disease results from absence of the following from lysosomal enzymes: (A) Signal sequence (B) Mannose-6-phosphate (C) Sialic acid (D) A serine residue
Description : The amino acids involved in the synthesis of creatin are (A) Arginine, glycine, active methionine (B) Arginine, alanine, glycine (C) Glycine, lysine, methionine (D) Arginine, lysine, methionine
Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine
Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin
Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
Description : Methylcobalamin is required for formation of (A) Serin from glycine (B) Glycine from serine (C) Methionine from homocysteine (D) All of these
Description : Methionine is synthesized in human body from (A) Cysteine and homoserine (B) Homocysteine and serine (C) Cysteine and serine (D) None of these
Description : Cysteine can be synthesized from methionine and (A) Serine (B) Homoserine (C) Homocysteine (D) Threonine
Description : In mammalian tissues serine can be a biosynthetic precursor of (A) Methionine (B) Glycine (C) Tryptophan (D) Phenylalanine
Description : Covalent modification of an enzyme usually involves phosphorylation / dephosphorylation of (A) Serine residue (B) Proline residue (C) Hydroxylysine residue (D) Hydroxyproline residue
Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
Last Answer : Ans. ((b))
Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix
Last Answer : the amino acid sequence in the polypeptide chain
Description : A disulphide bond can be formed between (A) Two methionine residues (B) Two cysteine residues (C) A methionine and a cysteine residue (D) All of these
Description : In the B chain of insulin molecule, the C-terminal amino acid: (A) Threonine (B) Tyrosine (C) Glutamate (D) Valine
Description : The proteins destined to be transported out of the cell have all the following features except (A) They possess a signal sequence (B) Ribosomes synthesizing them are bound to endoplasmic reticulum (C) After synthesis, they are delivered into Golgi apparatus (D) They are tagged with ubiquitin
Description : For the synthesis of TMP from dump, a coenzyme is required which is (A) N10- Formyl tetrahydrofolate (B) N5- Methyl tetrahydrofolate (C) N5, N10- Methylene tetrahydrofolate (D) N5- Formimino tetrahydrofolate
Description : The first reaction unique to purine nucleotide synthesis is catalysed by (A) PRPP synthetase (B) PRPP glutamyl amido transferase (C) Phosphoribosyl glycinamide synthetase (D) Formyl transferase
Description : For the synthesis of amino acids cysteine, cystine and methionine the element required is a. Sulphur b. Oxygen c. Nitrogen d. None of these
Last Answer : Ans: D
Description : Elongation of a peptide chain involves all the following except (A) mRNA (B) GTP (C) Formyl-Met-tRNA (D) Tu, TS and G factors
Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four
Last Answer : Three
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : A ketogenic amino acid among the following is (A) Leucine (B) Serine (C) Threonine (D) Proline
Description : Which of the following amino acid has been shown as one of the active site of phosphoglucomutase? (A) Lysine (B) Tyrosine (C) Serine (D) Histidine
Description : Activation or inactivation of certain key regulatory enzymes is accomplished by covalent modification of the amino acid: (A) Tyrosine (B) Phenylalanine (C) Lysine (D) Serine
Description : Which among the following is an essential amino acid for man? (A) Alanine (B) Serine (C) Valine (D) Glutamic acid
Description : 2-Amino 3-OH propanoic acid is (A) Glycine (B) Alanine (C) Valine (D) Serine
Description : The lone pair of electrons at one of the ring nitrogens in the given amino acid makes a potential ligand, which is important in binding the iron atoms in hemoglobin: (A) Tryptophan (B) Threonine (C) Histidine (D) Serine
Description : One of the given example is an amino acid: (A) Oh-Lysine (B) Protein (C) Leucine (D) Serine
Description : Seratonin is derived in the body from the following amino acid: (A) Phenylalanine (B) Histidine (C) Tryptophan (D) Serine