The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

1 Answer

Answer :

Answer :  C

Related questions

Description : In E. coli the chain initiating amino acid in protein synthesis is (A) N-formyl methionine(B) Methionine (C) Serine (D) Cysteine

Last Answer : Answer : A

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

Description : A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, ... L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine

Last Answer : C.proteins are synthesized from

Description : A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine

Last Answer : .proteins are synthesized from D-, rather than L-, isomers of amino acids

Description : An amino acid having a hydrophilic side chain is (A) Alanine (B) Proline (C) Methionine (D) Serine

Last Answer : Answer : D

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

Description : The sulphur containing amino acid: (A) Homoserine (B) Serine (C) Methionine (D) Valine

Last Answer : Answer : C

Description : An essential amino acid in man is (A) Aspartate (B) Tyrosine (C) Methionine (D) Serine

Last Answer : Answer : C

Description : The metabolic reaction requiring vitamin B12 but not folate is: A. Conversion of malonic acid to succinic acid B. Conversion of homocysteine to methionine C. Conversion of serine to glycine D. Thymidylate synthesis

Last Answer : A. Conversion of malonic acid to succinic acid

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

Description : The figure shows a hypothetical tetrapeptide portion of a protein with parts labelled A-D. Which one of the following options is correct? - HN - CH - CO - NH - CH - CO - NH - CH - CO - ... -terminal amino acid and D is N-terminal amino acid. (d) A is a sulphur containing amino acid methionine.

Last Answer : (a) D is the acidic amino acid-glutamic acid.

Description : An amino acid required for porphyrin synthesis is (A) Proline (B) Glycine (C) Serine (D) Histidine

Last Answer : Answer : A

Description : The amino acid from which synthesis of the protein of hair keratin takes place is (A) Alanine (B) Methionine (C) Proline (D) Hydroxyproline

Last Answer : Answer : B

Description : In A chain of the insulin molecule the Nterminal amino acid is (A) Glycine (B) Valine (C) Serine (D) Phenylalanine

Last Answer : Answer : A

Description : The amino acid with a nonpolar side chain is (A) Serine (B) Valine (C) Asparagine (D) Threonine

Last Answer : Answer : B

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

Description : Vitamin K is a cofactor for (A) Gamma carboxylation of glutamic acid residue (B) β-Oxidation of fatty acid (C) Formation of γ-amino butyrate (D) Synthesis of tryptophan

Last Answer : Answer : A

Description : The side chain of which of the following amino acid contain sulphur atom? (A) Methionine (B) Threonine (C) Leucine (D) Tryptophan

Last Answer : Answer : A

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

Description : Both folic acid and methyl cobalamin (vitamin B12) are required in (A) Deamination of serine (B) Deamination of threonine (C) Conversion of pyridoxal phosphate to pyridoxamine phosphate (D) Methylation of homocystein to methionine

Last Answer : Answer : D

Description : I-cell disease results from absence of the following from lysosomal enzymes: (A) Signal sequence (B) Mannose-6-phosphate (C) Sialic acid (D) A serine residue

Last Answer : Answer : D

Description : The amino acids involved in the synthesis of creatin are (A) Arginine, glycine, active methionine (B) Arginine, alanine, glycine (C) Glycine, lysine, methionine (D) Arginine, lysine, methionine

Last Answer : Answer : A

Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine

Last Answer : Answer : D

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

Description : Methylcobalamin is required for formation of (A) Serin from glycine (B) Glycine from serine (C) Methionine from homocysteine (D) All of these

Last Answer : Answer : C

Description : Methionine is synthesized in human body from (A) Cysteine and homoserine (B) Homocysteine and serine (C) Cysteine and serine (D) None of these

Last Answer : Answer : D

Description : Cysteine can be synthesized from methionine and (A) Serine (B) Homoserine (C) Homocysteine (D) Threonine

Last Answer : Answer : A

Description : In mammalian tissues serine can be a biosynthetic precursor of (A) Methionine (B) Glycine (C) Tryptophan (D) Phenylalanine

Last Answer : Answer : B

Description : Covalent modification of an enzyme usually involves phosphorylation / dephosphorylation of (A) Serine residue (B) Proline residue (C) Hydroxylysine residue (D) Hydroxyproline residue

Last Answer : Answer : A

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

Description : A disulphide bond can be formed between (A) Two methionine residues (B) Two cysteine residues (C) A methionine and a cysteine residue (D) All of these

Last Answer : Answer : B

Description : In the B chain of insulin molecule, the C-terminal amino acid: (A) Threonine (B) Tyrosine (C) Glutamate (D) Valine

Last Answer : Answer : A

Description : The proteins destined to be transported out of the cell have all the following features except (A) They possess a signal sequence (B) Ribosomes synthesizing them are bound to endoplasmic reticulum (C) After synthesis, they are delivered into Golgi apparatus (D) They are tagged with ubiquitin

Last Answer : Answer : D

Description : For the synthesis of TMP from dump, a coenzyme is required which is (A) N10- Formyl tetrahydrofolate (B) N5- Methyl tetrahydrofolate (C) N5, N10- Methylene tetrahydrofolate (D) N5- Formimino tetrahydrofolate

Last Answer : Answer : C

Description : The first reaction unique to purine nucleotide synthesis is catalysed by (A) PRPP synthetase (B) PRPP glutamyl amido transferase (C) Phosphoribosyl glycinamide synthetase (D) Formyl transferase

Last Answer : Answer : B

Description : For the synthesis of amino acids cysteine, cystine and methionine the element required is a. Sulphur b. Oxygen c. Nitrogen d. None of these

Last Answer : Ans: D

Description : Elongation of a peptide chain involves all the following except (A) mRNA (B) GTP (C) Formyl-Met-tRNA (D) Tu, TS and G factors

Last Answer : Answer : C

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Description : A ketogenic amino acid among the following is (A) Leucine (B) Serine (C) Threonine (D) Proline

Last Answer : Answer : A

Description : Which of the following amino acid has been shown as one of the active site of phosphoglucomutase? (A) Lysine (B) Tyrosine (C) Serine (D) Histidine

Last Answer : Answer : C

Description : Activation or inactivation of certain key regulatory enzymes is accomplished by covalent modification of the amino acid: (A) Tyrosine (B) Phenylalanine (C) Lysine (D) Serine

Last Answer : Answer : D

Description : Which among the following is an essential amino acid for man? (A) Alanine (B) Serine (C) Valine (D) Glutamic acid

Last Answer : Answer : C

Description : 2-Amino 3-OH propanoic acid is (A) Glycine (B) Alanine (C) Valine (D) Serine

Last Answer : Answer : D

Description : The lone pair of electrons at one of the ring nitrogens in the given amino acid makes a potential ligand, which is important in binding the iron atoms in hemoglobin: (A) Tryptophan (B) Threonine (C) Histidine (D) Serine

Last Answer : Answer : C

Description : One of the given example is an amino acid: (A) Oh-Lysine (B) Protein (C) Leucine (D) Serine

Last Answer : Answer : B

Description : Seratonin is derived in the body from the following amino acid: (A) Phenylalanine (B) Histidine (C) Tryptophan (D) Serine

Last Answer : Answer : C