hich one out of these is not a data link layer technology:- a) Bluetooth b) UART c) WiFi d) HTTP

hich one out of these is not a data link layer technology:-
a) Bluetooth
b) UART
c) WiFi
d) HTTP
by

1 Answer

Answer :

d) HTTP
by

Related questions

Which one out of these is not a data link layer technology: a. Bluetooth b. UART c. WIFI d. HTTP

Description : Which one out of these is not a data link layer technology: a. Bluetooth b. UART c. WIFI d. HTTP

Last Answer : d. HTTP

Which one out of these is not a data link layer technology? A. Bluetooth B. UART C. Wi-Fi D. HTTP

Description : Which one out of these is not a data link layer technology? A. Bluetooth B. UART C. Wi-Fi D. HTTP

Last Answer : D. HTTP 

HTTP is ________ protocol. a) application layer b) transport layer c) network layer d) data link layer

Description : HTTP is ________ protocol. a) application layer b) transport layer c) network layer d) data link layer

Last Answer : a) application layer

Which is a link layer protocol? a) ARP b) TCP c) UDP d) HTTP

Description : Which is a link layer protocol? a) ARP b) TCP c) UDP d) HTTP

Last Answer : b) TCP

The line control unit (LCU) operates on the data digital form. A. Data communications equipment (DCE) B. UART C. Modem D. Data terminal equipment (DTE)

Description : The line control unit (LCU) operates on the data digital form. A. Data communications equipment (DCE) B. UART C. Modem D. Data terminal equipment (DTE)

Last Answer : D. Data terminal equipment (DTE)

hich is not the commonly used programming language for AI? ⮚ PROLOG ⮚ LISP ⮚ Perl ⮚ Java script

Description : hich is not the commonly used programming language for AI? ⮚ PROLOG ⮚ LISP ⮚ Perl ⮚ Java script

Last Answer : ⮚ Perl

The _____layer defines the electrical and physical specifications for devices: a) Data Link Layer b) Presentation Layer c) Physical Layer d) None of These

Description : The _____layer defines the electrical and physical specifications for devices: a) Data Link Layer b) Presentation Layer c) Physical Layer d) None of These

Last Answer : c) Physical Layer

The............ layer of OSI model can use the trailer of the frame for error detection. A) Physical B) Data link C) Transport D) Presentation

Description : The............ layer of OSI model can use the trailer of the frame for error detection. A) Physical B) Data link C) Transport D) Presentation

Last Answer : A) Physical

In Bluetooth, the_____ link is used when data integrity is more important than avoiding latency. A) SCO B) ACL C) ACO D) SCL

Description : In Bluetooth, the_____ link is used when data integrity is more important than avoiding latency. A) SCO B) ACL C) ACO D) SCL

Last Answer : ACL

In Bluetooth, the_____ link is used when avoiding latency (delay in data delivery) is more important than integrity (error-free delivery). A) SCO B) ACL C) ACO D) SCL

Description : In Bluetooth, the_____ link is used when avoiding latency (delay in data delivery) is more important than integrity (error-free delivery). A) SCO B) ACL C) ACO D) SCL

Last Answer : SCO

What is the full form of UART ?

Last Answer : Universal Asynchronous Receiver / Transmitter

What is the full form of UART ?

Last Answer : Universal Asynchronous Receiver / Transmitter

In microcontrollers, UART is acronym of_____ A. Universal Applied Receiver/Transmitter B. Universal Asynchronous Rectified Transmitter C. Universal Asynchronous Receiver/Transmitter D. United Asynchronous Receiver/Transmitter

Description : In microcontrollers, UART is acronym of_____ A. Universal Applied Receiver/Transmitter B. Universal Asynchronous Rectified Transmitter C. Universal Asynchronous Receiver/Transmitter D. United Asynchronous Receiver/Transmitter

Last Answer : C. Universal Asynchronous Receiver/Transmitter 

Explain how UART is used for communication highlighting the advantages of UART.

Last Answer : UART takes parallel data and transmits serially and UART receives serial data and converts to parallel.A simple UART may possess1.Some configuration registers and2.Two independently operating processors, one ... must write data to the transmit register and/or read data from the received register.

Does using meaningful words as part of the Http link helps to get more Google search results of that link? Why is that?

Description : Does using meaningful words as part of the Http link helps to get more Google search results of that link? Why is that?

Last Answer : answer:It goes according to key words, yes. The search engine crawls the web, looking for the key words you input. The stronger the search engine, the deeper the search. Some serch engines use other search ... are the most specific way to get dead-on hits? Do you know how to do a Boolean search?

Which protocol is used to link all the devices in the IoT? A. TCP/IP B. Network C. UDP D. HTTP

Description : Which protocol is used to link all the devices in the IoT? A. TCP/IP B. Network C. UDP D. HTTP

Last Answer : A. TCP/IP 

Match the following IEEE No to their corresponding Name for IEEE 802 standards for LANs. i) 802.3 a) WiFi ii) 802.11 b) WiMa iii) 802.15.1 c) Ethernet iv) 802.16 d) Bluetooth a. i-b, ii-c, iii-d, iv-a b. i-c, ii-d, iii-a, iv-b c. i-c, ii-a, iii-d, iv-b d. i-b, ii-d, iii-c, iv-a

Description : Match the following IEEE No to their corresponding Name for IEEE 802 standards for LANs. i) 802.3 a) WiFi ii) 802.11 b) WiMa iii) 802.15.1 c) Ethernet iv) 802.16 d) Bluetooth a. i-b, ii-c, iii-d, iv-a b. i-c, ii-d, iii-a, iv-b c. i-c, ii-a, iii-d, iv-b d. i-b, ii-d, iii-c, iv-a

Last Answer : c. i-c, ii-a, iii-d, iv-b

Match the following IEEE No to their corresponding Name for IEEE 802 standards for LANs. i) 802.3 a) WiFi ii) 802.11 b) WiMa iii) 802.15.1 c) Ethernet iv) 802.16 d) Bluetooth A) i-b, ii-c, iii-d, iv-a B) i-c, ii-d, iii-a, iv-b C) i-c, ii-a, iii-d, iv-b D) i-b, ii-d, iii-c, iv-a

Description : Match the following IEEE No to their corresponding Name for IEEE 802 standards for LANs. i) 802.3 a) WiFi ii) 802.11 b) WiMa iii) 802.15.1 c) Ethernet iv) 802.16 d) Bluetooth A) i-b, ii-c, iii-d, iv-a B) i-c, ii-d, iii-a, iv-b C) i-c, ii-a, iii-d, iv-b D) i-b, ii-d, iii-c, iv-a

Last Answer : C) i-c, ii-a, iii-d, iv-b

MQTT is better than HTTP for sending and receiving data. A. True B. False

Description : MQTT is better than HTTP for sending and receiving data. A. True B. False

Last Answer : A. True

MQTT is better than HTTP for sending and receiving data. a) True b) False 4. MQTT is _________ protocol. a) Machine to Machine b) Internet of Things c) Machine to Machine and Internet of Things d) Machine things

Description : MQTT is _________ protocol. a) Machine to Machine b) Internet of Things c) Machine to Machine and Internet of Things d) Machine things

Last Answer : c) Machine to Machine and Internet of Things

hich of the following statements is correct? (a) All metals are ductile. -Science

Description : hich of the following statements is correct? (a) All metals are ductile. -Science

Last Answer : Answer is (c) Generally, metals are ductile.

hich section is the remaining part of a process’s code: a. Racing section b. Critical section Cc. Entry section d. Reminder secti

Description : hich section is the remaining part of a process’s code: a. Racing section b. Critical section Cc. Entry section d. Reminder secti

Last Answer : b. Entry section

hich of the following is the most suitable abrasive for grinding high tensile strength materials? (A) Silicon carbide (B) Corundum (C) Aluminium oxide (D) Boron carbide

Description : hich of the following is the most suitable abrasive for grinding high tensile strength materials? (A) Silicon carbide (B) Corundum (C) Aluminium oxide (D) Boron carbide

Last Answer : Option C

hich is the substance which can act both as an acid and a base?

Description : hich is the substance which can act both as an acid and a base?

Last Answer : Amphoteric

hich following organs convert glycogen into glucose and purifier blood.

Description : hich following organs convert glycogen into glucose and purifier blood.

Last Answer : Liver

hich exchange-rate system involves a “leaning against the wind” strategy in which short-term fluctuations in exchange rates are reduced without adhering to any particular exchange rate over the long run? A. Pegged or fixed exchange rates B. Adjustable pegged exchange rates C. Managed floating exchange rates D. Freely floating exchange rates

Description : hich exchange-rate system involves a leaning against the wind strategy in which short-term fluctuations in exchange rates are reduced without adhering to any particular exchange rate over ... Adjustable pegged exchange rates C. Managed floating exchange rates D. Freely floating exchange rates

Last Answer : C. Managed floating exchange rates

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

hich of the following burst is used to broadcast the frequency and time synchronization control messages? a) FCCH and SCH b) TCH and DCCH c) RACH and TCH d) FCCH and DCCH

Description : hich of the following burst is used to broadcast the frequency and time synchronization control messages? a) FCCH and SCH b) TCH and DCCH c) RACH and TCH d) FCCH and DCCH

Last Answer : a) FCCH and SCH

hich is the less toxic herbicide? a). Atrazine b). 2,4-D c). Simazine d). All of these

Description : hich is the less toxic herbicide? a). Atrazine b). 2,4-D c). Simazine d). All of these

Last Answer : d). All of these

Which of the following is/are example(s) of stateful application layer protocols? (i) HTTP (ii) FTP (iii) TCP (iv) POP3 a. (i) and (ii) only b. (ii) and (iii) only c. (ii) and (iv) only d. (iv) only

Description : Which of the following is/are example(s) of stateful application layer protocols? (i) HTTP (ii) FTP (iii) TCP (iv) POP3 a. (i) and (ii) only b. (ii) and (iii) only c. (ii) and (iv) only d. (iv) only

Last Answer : c. (ii) and (iv) only

A layer-4 firewall (a device that can look at all protocol headers up to the transport layer) CANNOT a. block entire HTTP traffic during 9:00PM and 5 :0OAM b. block all ICMP trafficc. stop incoming traffic from a specific IP address but allow outgoing traffic to the same IP address d. block TCP traffic from a specific user on a multi-user system during 9:00PM and 5:00AM

Description : A layer-4 firewall (a device that can look at all protocol headers up to the transport layer) CANNOT a. block entire HTTP traffic during 9:00PM and 5 :0OAM b. block all ICMP traffic c. stop ... address d. block TCP traffic from a specific user on a multi-user system during 9:00PM and 5:00AM

Last Answer : d. block TCP traffic from a specific user on a multi-user system during 9:00PM and 5:00AM

Which of the following are transport layer protocols used in networking? a. TCP and FTP b. UDP and HTTP c. TCP and UDP d. HTTP and FTP

Description : Which of the following are transport layer protocols used in networking? a. TCP and FTP b. UDP and HTTP c. TCP and UDP d. HTTP and FTP

Last Answer : c. TCP and UDP

Which of the following are transport layer protocols used in networking? a. TCP and FTP b. UDP and HTTP c. TCP and UDP d. HTTP and FTP

Description : Which of the following are transport layer protocols used in networking? a. TCP and FTP b. UDP and HTTP c. TCP and UDP d. HTTP and FTP

Last Answer : c. TCP and UDP

Which protocol does HTTP (Hyper Text Transfer Protocol) - use for transferring web pages at the Transport layer a. IP b. UDP c. TCP d. ARP

Description : Which protocol does HTTP (Hyper Text Transfer Protocol) - use for transferring web pages at the Transport layer a. IP b. UDP c. TCP d. ARP

Last Answer : c. TCP

When displaying a web page, the application layer uses the _____________A. HTTP protocol B. FTP protocol C. SMTP protocol D. TCP protocol

Description : When displaying a web page, the application layer uses the _____________ A. HTTP protocol B. FTP protocol C. SMTP protocol D. TCP protocol

Last Answer : A. HTTP protocol

Electronic mail uses which Application layer protocol? A. SMTP B. HTTP C. FTP D. SIP

Description : Electronic mail uses which Application layer protocol? A. SMTP B. HTTP C. FTP D. SIP

Last Answer : A. SMTP

Which is not a application layer protocol? A. HTTP B. SMTP C. FTP D. UDP

Description : Which is not a application layer protocol? A. HTTP B. SMTP C. FTP D. UDP

Last Answer : D. UDP

Which of the following are used as transport layer protocols in networking? A. TCP and FTP B. UDP and HTTP C. TCP and UDP D. HTTP and FTP

Description : Which of the following are used as transport layer protocols in networking? A. TCP and FTP B. UDP and HTTP C. TCP and UDP D. HTTP and FTP

Last Answer : C. TCP and UDP

Which of the following are transport layer protocols used in networking? a) TCP and FTP b) UDP and HTTP c) TCP and UDP d) HTTP and FTP

Description : Which of the following are transport layer protocols used in networking? a) TCP and FTP b) UDP and HTTP c) TCP and UDP d) HTTP and FTP

Last Answer : c) TCP and UDP

The layer one of the OSI model is A) Physical layer B) Link layer C) Router layer D) Broadcast layer

Description : The layer one of the OSI model is A) Physical layer B) Link layer C) Router layer D) Broadcast layer

Last Answer : A) Physical layer

Why won't my Apple bluetooth headset link with my iPhone?

Description : Why won't my Apple bluetooth headset link with my iPhone?

Last Answer : I got a defective bluetooth apple mouse, that would pair for a couple seconds, and then drop, and have to be repaired. I'd bring it to your local Genius Bar, and see if they can't swap it out for ... correctly for you, they'll give you a new one on the spot. As long as it's under warranty still!

What is the minimum number of wires needed to send data over a serial communication link layer? a. 1 b. 2 c. 4 d. 6 e. none of above

Description : What is the minimum number of wires needed to send data over a serial communication link layer? a. 1 b. 2 c. 4 d. 6 e. none of above

Last Answer : 2

In OSI network architecture, the routing is performed by a. network layer b. data link layer c. transport layer d. session layer e. none of above

Description : In OSI network architecture, the routing is performed by a. network layer b. data link layer c. transport layer d. session layer e. none of above

Last Answer : network layer

In OSI network architecture, the dialogue control and token management are responsibility of a. session layer b. network layer c. transport layer d. data link layer e. none of above

Description : In OSI network architecture, the dialogue control and token management are responsibility of a. session layer b. network layer c. transport layer d. data link layer e. none of above

Last Answer : session layer

The _______ layer of Ethernet consistsof the LLC sublayer and the MAC sublayer. A) data link B) physical C) network D) none of the above

Description : The _______ layer of Ethernet consistsof the LLC sublayer and the MAC sublayer. A) data link B) physical C) network D) none of the above

Last Answer : data link

A ________operates in both thephysical andthe data link layer. A) passive hub B) repeater C) bridge D) router

Description : A ________operates in both thephysical andthe data link layer. A) passive hub B) repeater C) bridge D) router

Last Answer : bridge

A repeater is a connecting devicethat operates in the _______ layer of theInternet model. A) physical B) data link C) network D) all of theabove

Description : A repeater is a connecting devicethat operates in the _______ layer of theInternet model. A) physical B) data link C) network D) all of theabove

Last Answer : physical

_______ inthe data link layer separates a message from one source toa destination, or from other messages going from other sources to other destinations. A) Digitizing B) Controlling C) Framing D) none of the above

Description : _______ inthe data link layer separates a message from one source toa destination, or from other messages going from other sources to other destinations. A) Digitizing B) Controlling C) Framing D) none of the above

Last Answer : Framing

At the data link layer, Frame Relayusesa protocol that supports _____control. A) flow B) error C) either (a) or (bD)neither (a) nor (b)

Description : At the data link layer, Frame Relayusesa protocol that supports _____control. A) flow B) error C) either (a) or (b D) neither (a) nor (b)

Last Answer : neither (a) nor (b)

Frame Relay has_______. A) only the physical layer B) only thedata link C) the physical and data link layers D) the physical, data link, andnetwork layers

Description : Frame Relay has_______. A) only the physical layer B) only thedata link C) the physical and data link layers D) the physical, data link, andnetwork layers

Last Answer : the physical and data link layers