Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes

Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes
by

1 Answer

Answer :

Answer :  C
by
selected

Related questions

In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Description : In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Last Answer : all above

Besides structural genes that encode proteins, DNA contains some regulatory sequences which are known as (A) Operons (B) Cistrons (C) Cis-acting elements (D) Trans-acting factors

Description : Besides structural genes that encode proteins, DNA contains some regulatory sequences which are known as (A) Operons (B) Cistrons (C) Cis-acting elements (D) Trans-acting factors

Last Answer : Answer : C

In split genes, the coding sequences are called (a) exons (b) cistrons (c) introns (d) operons

Description : In split genes, the coding sequences are called (a) exons (b) cistrons (c) introns (d) operons

Last Answer : (d) operons.

In split genes, the coding sequences are called (a) exons (b) cistrons (c) introns (d) operons.

Description : In split genes, the coding sequences are called (a) exons (b) cistrons (c) introns (d) operons.

Last Answer : (a) exons

The coding sequences found in split genes are called a) Operons b) introns c) exons d) cistrons

Description : The coding sequences found in split genes are called a) Operons b) introns c) exons d) cistrons

Last Answer : c) exons

Non-coding sequences in a gene are known as (A) Cistrons (B) Nonsense codons (C) Introns (D) Exons

Description : Non-coding sequences in a gene are known as (A) Cistrons (B) Nonsense codons (C) Introns (D) Exons

Last Answer : Answer : C

The Golgi complex plays a major role (a) as energy transferring organelles (b) in post translational modification of proteins and glycosylation of lipids (c) in trapping the light and transforming it into chemical energy (d) in digesting proteins and carbohydrates.

Description : The Golgi complex plays a major role (a) as energy transferring organelles (b) in post translational modification of proteins and glycosylation of lipids (c) in trapping the light and transforming it into chemical energy (d) in digesting proteins and carbohydrates.

Last Answer : (b) in post translational modification of proteins and glycosylation of lipids

In a eukaryotic microbe, those sections of a primary RNA transcript that will NOT be translated are called a. Introns. b. Anticodons. c. ―Jumping Genes.‖ d. Exons.

Description : In a eukaryotic microbe, those sections of a primary RNA transcript that will NOT be translated are called a. Introns. b. Anticodons. c. ―Jumping Genes.‖ d. Exons.

Last Answer : a. Introns.

Bence-Jones proteins possess all the following properties except (A) They are dimers of light chains (B) Their amino acids sequences are identical (C) Their N-terminal halves have variable amino acid sequences (D) Their C-terminal halves have constant amino acid sequences

Description : Bence-Jones proteins possess all the following properties except (A) They are dimers of light chains (B) Their amino acids sequences are identical (C) Their N-terminal halves have variable amino acid sequences (D) Their C-terminal halves have constant amino acid sequences

Last Answer : Answer : B

Silencer elements (A) Are trans-acting factors (B) Are present between promoters and the structural genes (C) Decrease the expression of some structural genes (D) Encode specific repressor proteins

Description : Silencer elements (A) Are trans-acting factors (B) Are present between promoters and the structural genes (C) Decrease the expression of some structural genes (D) Encode specific repressor proteins

Last Answer : Answer : C

Cistron is a) The coding sequence of DNA b) The functional unit of DNA molecule that codes for a particular gene product c) Intervening non coding sequence of DNA d) The sequences which are removed during RNA splicing.

Description : Cistron is a) The coding sequence of DNA b) The functional unit of DNA molecule that codes for a particular gene product c) Intervening non coding sequence of DNA d) The sequences which are removed during RNA splicing.

Last Answer : b) The functional unit of DNA molecule that codes for a particular gene product c) Intervening non coding sequence of DNA

The coding sequences in lac operon include (A) i gene (B) i gene, operator locus and promoter (C) z, y and a genes (D) i, z, y and a genes

Description : The coding sequences in lac operon include (A) i gene (B) i gene, operator locus and promoter (C) z, y and a genes (D) i, z, y and a genes

Last Answer : Answer : D

Post-transcriptional modification of hnRNA involves all of the following except (A) Addition of 7-methylguanosine triphosphate cap (B) Addition of polyadenylate tail (C) Insertion of nucleotides (D) Deletion of introns

Description : Post-transcriptional modification of hnRNA involves all of the following except (A) Addition of 7-methylguanosine triphosphate cap (B) Addition of polyadenylate tail (C) Insertion of nucleotides (D) Deletion of introns

Last Answer : Answer : C

DNA finger printing is based on the presence in DNA of (A) Constant number of tandem repeats (B) Varibale number of tandem repeats (C) Non-repititive sequences in each DNA (D) Introns in eukaryotic DNA

Description : DNA finger printing is based on the presence in DNA of (A) Constant number of tandem repeats (B) Varibale number of tandem repeats (C) Non-repititive sequences in each DNA (D) Introns in eukaryotic DNA

Last Answer : Answer : B

In split genes the coding sequences are called

Description : 4. In split genes the coding sequences are called (a)introns (b)operons (c)exons (d)cistrons

Last Answer : (c)exons

Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- Restriction endonuclease can cleave ss and dsDNA both C- Restriction fragment length polymorphism (RFLP) is usually formed in coding sequenceof a gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Description : Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- Restriction endonuclease can cleave ss and dsDNA both C- Restriction ... sequenceof a gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Last Answer : Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction fragment length polymorphism (RFLP) is usually formed in coding sequence of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Description : Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction ... of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Last Answer : Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction fragment length polymorphism (RFLP) is usually formed in coding sequence of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Description : Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction ... of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Last Answer : Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

All of the following statements about post-transcriptional processing of tRNA are true except (A) Introns of some tRNA precursors are removed (B) CCA is added at 3′ end (C) 7-Methylguanosine triphosphate cap is added at 5′ end (D) Some bases are methylated

Description : All of the following statements about post-transcriptional processing of tRNA are true except (A) Introns of some tRNA precursors are removed (B) CCA is added at 3′ end (C) 7-Methylguanosine triphosphate cap is added at 5′ end (D) Some bases are methylated

Last Answer : Answer : C

Genetic code is said to be degenerate because (A) It can undergo mutations (B) A large proportion of DNA is non-coding (C) One codon can code for more than one amino acids (D) More than one codons can code for the same amino acids

Description : Genetic code is said to be degenerate because (A) It can undergo mutations (B) A large proportion of DNA is non-coding (C) One codon can code for more than one amino acids (D) More than one codons can code for the same amino acids

Last Answer : Answer : D

Increased serum alanine during fasting is due to (A) Breakdown of muscle proteins (B) Decreased utilization of non essential amino acids (C) Leakage of aminoacids to plasma (D) Impaired renal function

Description : Increased serum alanine during fasting is due to (A) Breakdown of muscle proteins (B) Decreased utilization of non essential amino acids (C) Leakage of aminoacids to plasma (D) Impaired renal function

Last Answer : Answer : A

Non essential amino acids (A) Are not components of tissue proteins (B) May be synthesized in the body from essential amino acids (C) Have no role in the metabolism (D) May be synthesized in the body in diseased states

Description : Non essential amino acids (A) Are not components of tissue proteins (B) May be synthesized in the body from essential amino acids (C) Have no role in the metabolism (D) May be synthesized in the body in diseased states

Last Answer : Answer : B

Non essential amino acids (A) Are not components of tissue proteins (B) May be synthesized in the body from essential amino acids (C) Have no role in the metabolism (D) May be synthesized in the body in diseased states

Description : Non essential amino acids (A) Are not components of tissue proteins (B) May be synthesized in the body from essential amino acids (C) Have no role in the metabolism (D) May be synthesized in the body in diseased states

Last Answer : (B) May be synthesized in the body from essential amino acids

The basic idea behind Huffman coding is to A. compress data by using fewer bits to encode fewer frequently occuring characters B. compress data by using fewer bits to encode more frequently occuring characters C. compress data by using more bits to encode more frequently occuring characters D. expand data by using fewer bits to encode more frequently occuring characters

Description : The basic idea behind Huffman coding is to A. compress data by using fewer bits to encode fewer frequently occuring characters B. compress data by using fewer bits to encode more ... frequently occuring characters D. expand data by using fewer bits to encode more frequently occuring characters

Last Answer : B. compress data by using fewer bits to encode more frequently occuring characters

The basic idea behind Huffman coding is to a. compress data by using fewer bits to encode fewer frequently occuring characters b. compress data by using fewer bits to encode more frequently occuring characters c. compress data by using more bits to encode more frequently occuring characters d. expand data by using fewer bits to encode more frequently occuring characters

Description : The basic idea behind Huffman coding is to a. compress data by using fewer bits to encode fewer frequently occuring characters b. compress data by using fewer bits to encode more ... frequently occuring characters d. expand data by using fewer bits to encode more frequently occuring characters

Last Answer : b. compress data by using fewer bits to encode more frequently occuring characters

Non-coding sequence are present in the genes of (A) Bacteria (B) Viruses (C) Eukaryotes (D) All of these

Description : Non-coding sequence are present in the genes of (A) Bacteria (B) Viruses (C) Eukaryotes (D) All of these

Last Answer : Answer : C

Various oncogens may encode all of the following except: (A) Carcinogens (B) Growth factors (C) Receptors for growth factors (D) Signal transducers for growth factors

Description : Various oncogens may encode all of the following except: (A) Carcinogens (B) Growth factors (C) Receptors for growth factors (D) Signal transducers for growth factors

Last Answer : Answer : A

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Which of the following sequences has helped in identifying eukaryotes, eubacteria and A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Description : Which of the following sequences has helped in identifying eukaryotes, eubacteria and A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Last Answer : Signature sequence

Which of the following sequences has helped in identifying eukaryotes, eubacteria and archeabacterial cell types? A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Description : Which of the following sequences has helped in identifying eukaryotes, eubacteria and archeabacterial cell types? A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Last Answer : Signature sequence

8. Non coding sequences present within a gene is called: (a) Exon (b) Operon (c) Promoter (d) Intron

Description : 8. Non coding sequences present within a gene is called: (a) Exon (b) Operon (c) Promoter (d) Intron

Last Answer : (d) Intron

Bacterial genes lack (a) Exons (b) Introns (c) Prometers (d) Operator

Description : Bacterial genes lack (a) Exons (b) Introns (c) Prometers (d) Operator

Last Answer : (b) Introns

Ribosomes match up the ______ of the mRNA and the ______ of the tRNAs. a. codons; anticodons b. introns; exons c. anticodons; codons d. genes; anticodons

Description : Ribosomes match up the ______ of the mRNA and the ______ of the tRNAs. a. codons; anticodons b. introns; exons c. anticodons; codons d. genes; anticodons

Last Answer : a. codons; anticodons

RNA transcription is more complex in eukaryotes because it is first made as a primary RNA transcript that contains intron and exon sequences. What kind of modification must occur to produce a mature mRNA?

Description : RNA transcription is more complex in eukaryotes because it is first made as a primary RNA transcript that contains intron and exon sequences. What kind of modification must occur to produce a mature mRNA?

Last Answer : RNA splicing. Introns must be removed and exons are spliced together to form a mature RNA transcript.

Selectins are proteins that can recognise specific (A) Carbohydrates (B) Lipids (C) Amino acids (D) Nucleotides

Description : Selectins are proteins that can recognise specific (A) Carbohydrates (B) Lipids (C) Amino acids (D) Nucleotides

Last Answer : Answer : A

Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Last Answer : Answer : C

Phrynoderma is a deficiency of (A) Essential fatty acids(B) Proteins (C) Amino acids (D) None of these

Description : Phrynoderma is a deficiency of (A) Essential fatty acids(B) Proteins (C) Amino acids (D) None of these

Last Answer : Answer : A

Degradation of proteins to amino acids, glucose from carbohydrates and fatty acids from lipids is known as (A) Anabolism (B) Metabolism (C) Catabolism (D) Cretinism

Description : Degradation of proteins to amino acids, glucose from carbohydrates and fatty acids from lipids is known as (A) Anabolism (B) Metabolism (C) Catabolism (D) Cretinism

Last Answer : Answer : C

Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids

Description : Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids

Last Answer : Answer : C

Number of amino acids present in plants, animals and microbial proteins: (A) 20 (B) 80 (C) 150 (D) 200

Description : Number of amino acids present in plants, animals and microbial proteins: (A) 20 (B) 80 (C) 150 (D) 200

Last Answer : Answer : D

Polymers of more than 100 amino acids are termed (A) Proteins (B) Polypeptides (C) Both (A) and (B) (D) None of these

Description : Polymers of more than 100 amino acids are termed (A) Proteins (B) Polypeptides (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

Number of amino acids present in the dietary proteins: (A) 22 (B) 23 (C) 20 (D) 19

Description : Number of amino acids present in the dietary proteins: (A) 22 (B) 23 (C) 20 (D) 19

Last Answer : Answer : C

Number of amino acids present in the plant, animal and microbial proteins: (A) 20 (B) 80 (C) 150 (D) 200

Description : Number of amino acids present in the plant, animal and microbial proteins: (A) 20 (B) 80 (C) 150 (D) 200

Last Answer : Answer : A

For biosynthesis of proteins (A) Amino acids only are required (B) Amino acids and nucleic acids only are required (C) Amino acid, nucleic acids and ATP only are required (D) Amino acids, nucleic acids, ATP, GTP, enzymes and activators are required

Description : For biosynthesis of proteins (A) Amino acids only are required (B) Amino acids and nucleic acids only are required (C) Amino acid, nucleic acids and ATP only are required (D) Amino acids, nucleic acids, ATP, GTP, enzymes and activators are required

Last Answer : Answer : D

Enzyme catalyzed hydrolysis of proteins produces amino acids of the form: (A) D (B) L (C) DL (D) All of these

Description : Enzyme catalyzed hydrolysis of proteins produces amino acids of the form: (A) D (B) L (C) DL (D) All of these

Last Answer : Answer : B

Tertiary structure of a protein describes (A) The order of amino acids (B) Location of disulphide bonds (C) Loop regions of proteins (D) The ways of protein folding

Description : Tertiary structure of a protein describes (A) The order of amino acids (B) Location of disulphide bonds (C) Loop regions of proteins (D) The ways of protein folding

Last Answer : Answer : D

All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine

Description : All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine

Last Answer : Answer : D

Proteins contain (A) Only L- α - amino acids (B) Only D-amino acids (C) DL-Amino acids (D) Both (A) and (B)

Description : Proteins contain (A) Only L- α - amino acids (B) Only D-amino acids (C) DL-Amino acids (D) Both (A) and (B)

Last Answer : Answer : A

All proteins contain the (A) Same 20 amino acids (B) Different amino acids (C) 300 Amino acids occurring in nature (D) Only a few amino acids

Description : All proteins contain the (A) Same 20 amino acids (B) Different amino acids (C) 300 Amino acids occurring in nature (D) Only a few amino acids

Last Answer : Answer : A

Mucopolysaccharides are (A) Hamopolysaccharides (B) Hetropolysaccharides (C) Proteins (D) Amino acids

Description : Mucopolysaccharides are (A) Hamopolysaccharides (B) Hetropolysaccharides (C) Proteins (D) Amino acids

Last Answer : A