hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

hich mRNA will be translated to a polypeptide chain containing 8 amino acids?  a) AUGUUAAUAGACGAGUAGCGACGAUGU  
b) AUGAGACGGACUGCAUUCCCAACCUGA
c) AUGCCCAACCGUUAUUCAUGCUAG
d) AUGUCGACAGUCUAAAACAGCGGG
by

1 Answer

Answer :

b) AUGAGACGGACUGCAUUCCCAACCUGA
by

Related questions

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Last Answer : Answer : A

Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids

Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids

Last Answer : Answer : C

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes

Description : Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes

Last Answer : Answer : C

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Last Answer : Answer : C

The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Description : The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Last Answer : Ans:(d)

A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Description : A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Last Answer : a. 332

mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Description : mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Last Answer : Answer : A

A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Description : A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Last Answer : Answer : A

Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Description : Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Last Answer : Answer : D

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Last Answer : (b) polyhedral bodies

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Last Answer : polysome

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome

Last Answer : (1) Polysome

Where does the mRNA get translated in to protein?

Description : Where does the mRNA get translated in to protein?

Last Answer : Need answer

The first codon to be translated on mRNA is (A) AUG (B) GGU (C) GGA (D) AAA

Description : The first codon to be translated on mRNA is (A) AUG (B) GGU (C) GGA (D) AAA

Last Answer : Answer : A

Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the cytoplasm. C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.

Description : Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the ... activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.

Last Answer : C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes.

Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid

Description : Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid

Last Answer : Answer : A

Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid

Description : Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid

Last Answer : (A) 2-Amino 5-guanidovaleric acid

Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids

Description : Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids

Last Answer : Answer : C

Sulphur containing amino acids after catabolism produces a substance which is excreted: (A) SO2 (B) HNO3 (C) H2SO4 (D) H3PO4

Description : Sulphur containing amino acids after catabolism produces a substance which is excreted: (A) SO2 (B) HNO3 (C) H2SO4 (D) H3PO4

Last Answer : Answer : C

The third active process for amino acids transport involves (A) Acidic amino acids (B) Basic amino acids (C) Neutral amino acids (D) Sulphur containing amino acids

Description : The third active process for amino acids transport involves (A) Acidic amino acids (B) Basic amino acids (C) Neutral amino acids (D) Sulphur containing amino acids

Last Answer : Answer : C

Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues

Description : Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues

Last Answer : Answer : A

All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine

Description : All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine

Last Answer : Answer : D

Essential amino acids have been advocated as standard therapy for renal failure. Which of the following statements are true? A. Increased survival from acute renal failure has been reported with both essential and nonessential amino acid therapy of patients in renal failure. B. Essential amino acids retard the rise of blood urea nitrogen (BUN) secondary to decreased urea appearance. C. Essential amino acids and hypertonic dextrose are a convenient form of therapy for hyperkalemia. D. Essential amino acids decrease BUN and creatinine to the same degree as solutions containing excessive nonessential amino acids.

Description : Essential amino acids have been advocated as standard therapy for renal failure. Which of the following statements are true? A. Increased survival from acute renal failure has been reported ... BUN and creatinine to the same degree as solutions containing excessive nonessential amino acids.

Last Answer : Answer: BC DISCUSSION: Essential amino acids and hypertonic dextrose, as opposed to hypertonic dextrose alone, was reported by Abel and co-workers to be associated with a decreased mortality rate ... renal failure have not been carried out in sufficient numbers to yield answers to this question

Name the Sulfur containing amino acids.

Description : Name the Sulfur containing amino acids.

Last Answer : Cysteine and methionine.

All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine

Description : All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine

Last Answer : (D) Threonine

Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four heme groups. As a protein composed of association of polypeptide chains, the functionality of hemoglobin depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule

Description : Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four ... depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule

Last Answer : On average what is the life duration of the red blood cells?

The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?

Description : The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?

Last Answer : beads of different colors joined together on a piece of string

What type of molecule is made from a long chain of amino acids?

Description : What type of molecule is made from a long chain of amino acids?

Last Answer : protein