Description : The active site of an enzyme is formed by a few of the enzymes: (A) R groups of the amino acids (B) Amino groups of the amino acids (C) Carboxyl group of the amino acids (D) Exposed sulfur bonds
Last Answer : Answer : C
Description : Glycine is a unique amino acid because it (a) has no chiral carbon (b) has a sulfur containing R group (c) cannot form a peptide bond (d) is an essential amino acid
Last Answer : has no chiral carbon
Description : Which of the following amino acids has a sulfur in the R group? (a) Serine (b) Cysteine (c) Asparagine (d) Tyrosine
Last Answer : Tyrosine
Description : Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids
Description : Sulphur containing amino acids after catabolism produces a substance which is excreted: (A) SO2 (B) HNO3 (C) H2SO4 (D) H3PO4
Description : The third active process for amino acids transport involves (A) Acidic amino acids (B) Basic amino acids (C) Neutral amino acids (D) Sulphur containing amino acids
Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids
Description : Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues
Last Answer : Answer : A
Description : All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine
Last Answer : Answer : D
Last Answer : (D) Threonine
Description : The shape of an enzyme and consequently its activity can be reversibly altered from moment to moment by (A) Heat (B) Amino acid substrate (C) Allosteric subunits (D) Sulfur substitutions
Description : Essential amino acids have been advocated as standard therapy for renal failure. Which of the following statements are true? A. Increased survival from acute renal failure has been reported ... BUN and creatinine to the same degree as solutions containing excessive nonessential amino acids.
Last Answer : Answer: BC DISCUSSION: Essential amino acids and hypertonic dextrose, as opposed to hypertonic dextrose alone, was reported by Abel and co-workers to be associated with a decreased mortality rate ... renal failure have not been carried out in sufficient numbers to yield answers to this question
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Which of the following is believed to be responsible for the hole in the ozone layer over Antarctic? w) carbon dioxide x) compounds containing sulfur y) radioactivity z) compounds containing chlorine
Last Answer : ANSWER: Z -- COMPOUNDS CONTAINING CHLORINE
Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY
Last Answer : Answer : B
Description : A molybdenum containing oxidase is (A) Cytochrome oxidase (B) Xanthine oxidase (C) Glucose oxidase (D) L-Amino acid oxidase
Description : Chemically, lipoic acid is (A) Saturated fatty acid (B) Unsaturated fatty acid (C) Amino acid (D) Sulphur containing fatty acid
Description : In biotin-containing enzymes, the biotin is bound to the enzyme by (A) An amide linkage to carboxyl group of glutamine (B) A covalent bond with CO2 (C) An amide linkage to an amino group of lysine (D) An amide linkage to α-carboxyl group of protein
Description : The amino acid containing hydroxy group: (A) Glycine (B) Isoleucine (C) Arginine (D) Thereonine
Description : Ethereal sulphate is synthesized from the _________ amino acid. (A) Neutral (B) Acidic (C) Basic (D) Sulphur containing
Description : The amino acid containing an indole ring: (A) Tryptophan (B) Arginine (C) Threonine (D) Phenylalanine
Description : The sulphur containing amino acid: (A) Homoserine (B) Serine (C) Methionine (D) Valine
Description : The amino acid containing hydroxyl group: (A) Alanine (B) Isoleucine (C) Arginine (D) Threonine
Description : An amino acid not containing the usual— COOH group is (A) Alanine (B) Tryptophan (C) Methionine (D) Taurine
Description : Sulphur-containing amino acid is (A) Glutathione (B) Chondroitin sulphate (C) Homocysteine (D) Tryptophan
Description : Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid
Description : An example of sulphur containing amino acid is (A) 2-Amino-3-mercaptopropanoic acid (B) 2-Amino-3-methylbutanoic acid (C) 2-Amino-3-hydroxypropanoic acid (D) Amino acetic acid
Description : Sulphur containing amino acid is (A) Methionine (B) Leucine (C) Valine (D) Asparagine
Description : Amino acid containing a thio-ether bond is.
Last Answer : Methionine.
Last Answer : (A) 2-Amino 5-guanidovaleric acid
Last Answer : (A) 2-Amino-3-mercaptopropanoic acid
Last Answer : (A) Methionine
Description : (3) Oxides of nitrogen and sulphur Explanation: Acid rain is caused by emissions of oxides of Sulfur and Nitrogen (Sulfur Dioxide and Nitrogen Oxide), which react with the water molecules in the ... The emissions of sulfur dioxide (SO2) and nitrogen oxides (NOx) result from fossil fuel combustion.
Last Answer : (3) live wire and the neutral wire Explanation: Three wires enter most homes from the power pole-two "hot" wires and a third "neutral" wire. Each hot wire provides 120- volt current for ... the main switch is put off because the electric circuit (the path where the electricity travels) gets opened.
Description : (2) oxides of nitrogen and sulphur Explanation: Acid rain is caused by emissions of sulfur dioxide and nitrogen oxides, which react with the water molecules in the atmosphere to produce acids.
Last Answer : Neuron is - (1) Fundamental unit of energy (2) Particle released in radioactive emission (3) Antiparbcle of neutron (4) Fundamental unit of nervous system
Description : Waste gases from industrial plants form acids that hasten chemical weathering. Most of the gases are compounds of: w) argon x) hydrogen y) iron z) sulfur
Last Answer : ANSWER: Z -- SULFUR
Description : Hypolipidemic drugs reduce serum cholesterol and triacylglycerol. The effect of clofibrate is attributed to (A) Block in absorption from G.I.T. (B) Decrease in secretion of triacylglycerol and cholesterol ... by liver (C) Block in the reabsorption of bile acids (D) Decreased synthesis of cholesterol
Description : The fatty acids containing even number and odd number of carbon atoms as well as the unsaturated fatty acids are oxidized by (A) α-oxidation (B) β-oxidation (C) ω-oxidation (D) All of these
Description : For synthesis of prostaglandins, the essential fatty acids give rise to a fatty acid containing (A) 12 carbon atoms (B) 16 carbon atoms (C) 20 carbon atoms (D) 24 carbon atoms
Description : Calcium absorption is inferred by (A) Fatty acids (B) Amino acids (C) Vitamin D (D) Vitamin B12
Description : Degeneracy of the genetic code denotes the existence of (A) Base triplets that do not code for any amino acids (B) Codons consisting of only two bases (C) Codons that include one or more of the unusual bases (D) Multiple codons for a single amino acid
Description : Which of the following gives a positive Ninhydrin test? (A) Reducing sugar (B) Triglycerides (C) α-amino acids (D) Phospholipids
Description : Selectins are proteins that can recognise specific (A) Carbohydrates (B) Lipids (C) Amino acids (D) Nucleotides
Description : Glycoproteins are marked for destruction by removal of their (A) Oligosaccharide prosthetic group (B) Sialic acid residues (C) Mannose residues (D) N-terminal amino acids
Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein
Description : All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons
Description : Genetic code is said to be degenerate because (A) It can undergo mutations (B) A large proportion of DNA is non-coding (C) One codon can code for more than one amino acids (D) More than one codons can code for the same amino acids
Description : Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes
Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol
Description : In the process of activation of amino acids for protein synthesis, the number of high energy phosphate bond equivalent utilised is (A) 0 (B) 1 (C) 2 (D) 4
Description : The enzyme amino acyl tRNA synthetase is involved in (A) Dissociation of discharged tRNA from 80S ribosome (B) Charging of tRNA with specific amino acids (C) Termination of protein synthesis (D) Nucleophilic attack on esterified carboxyl group of peptidyl tRNA