Description : Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid
Last Answer : (A) 2-Amino 5-guanidovaleric acid
Description : An example of sulphur containing amino acid is (A) 2-Amino-3-mercaptopropanoic acid (B) 2-Amino-3-methylbutanoic acid (C) 2-Amino-3-hydroxypropanoic acid (D) Amino acetic acid
Last Answer : Answer : A
Last Answer : (A) 2-Amino-3-mercaptopropanoic acid
Description : Pyrrolidine group is present in which amino acid?
Last Answer : Proline.
Description : An example of α-amino acid not present in proteins but essential in mammalian metabolism is (A) 3-Amino 3-hydroxypropanoic acid (B) 2-Amino 3-hydroxybutanoic acid (C) 2-Amino 4-mercaptobutanoic acid (D) 2-Amino 3-mercaptopropanoic acid
Last Answer : Answer : C
Description : An example of -amino acid not present in proteins but essential in mammalian metabolism is (A) 3-Amino 3-hydroxypropanoic acid (B) 2-Amino 3-hydroxybutanoic acid (C) 2-Amino 4-mercaptobutanoic acid (D) 2-Amino 3-mercaptopropanoic acid
Last Answer : (C) 2-Amino 4-mercaptobutanoic acid
Description : 2-Amino 3-OH propanoic acid is (A) Glycine (B) Alanine (C) Valine (D) Serine
Last Answer : Answer : D
Description : Long chain alkanes or alkenes containing terminal carboxylic acid ( – COOH) are called
Last Answer : fatty acid.
Description : If the amino group and a carboxylic group of the amino acid are attached to same carbon atom, the amino acid is called as (A) Alpha (B) Beta (C) Gamma (D) Epsilon
Description : From two amino acids peptide bond formation involves removal of one molecule of (A) Water (B) Ammonia (C) Carbondioxide (D) Carboxylic acid
Description : If the amino group and a carboxylic group of the amino acid are attached to same carbon atom, the amino acid is called (A) Alpha (B) Beta (C) Gamma (D) Delta
Description : Ethereal sulphate is synthesized from the _________ amino acid. (A) Neutral (B) Acidic (C) Basic (D) Sulphur containing
Description : Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues
Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids
Description : The side chain of which of the following amino acid contain sulphur atom? (A) Methionine (B) Threonine (C) Leucine (D) Tryptophan
Description : An amino acid having a hydrophilic side chain is (A) Alanine (B) Proline (C) Methionine (D) Serine
Description : The amino acid with a nonpolar side chain is (A) Serine (B) Valine (C) Asparagine (D) Threonine
Last Answer : Answer : B
Description : Which of the following is the correct ranking in decreasing order of relative Boiling Point of carbonyl containing compounds? (a) primary amide > carboxylic acid >> ester ~ acyl chloride ~ aldehyde ~ ketone ... chloride ~ amide (d) carboxylic acid > amide >> ester ~ acyl chloride ~ aldehyde ~ ketone
Last Answer : primary amide > carboxylic acid >> ester ~ acyl chloride ~ aldehyde ~ ketone
Description : Protein is a polymer of (A) Sugars (B) Phenols (C) Amino acids (D) Carboxylic acids
Description : Group that reacts in the Biuret test: (A) Peptide (B) Amino group (C) Carboxylic group (D) Aldehyde group
Description : The third active process for amino acids transport involves (A) Acidic amino acids (B) Basic amino acids (C) Neutral amino acids (D) Sulphur containing amino acids
Description : The total number of carboxylic acid groups in the product P is
Last Answer : The total number of carboxylic acid groups in the product P is
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix
Last Answer : the amino acid sequence in the polypeptide chain
Description : How many percent of propanoic acid is hydrogen?
Last Answer : Propanoic acid is CH3CH2COOH. It has 3 carbons (3x12 = 36g), 2oxygens (2x16 = 32 g) and 6 hydrogens (6x1 = 6 g). The total mass =36+32+6 = 74g. Percent H = 6/74 (x100%) = 8.1%
Description : n-Propylmagnesium bromide on treatment with carbon dioxide and further hydrolysis gives : (a) Acetic acid (b) Propanoic acid (c) Butanoic acid (d) Formic acid
Last Answer : Butanoic acid
Description : The Grignard reagent, CH3CH2MgBr, can be used to prepare (a) Ethane (b) 3-Ethyl-3-pentanol (c) Propanoic acid (d) All of these
Last Answer : All of these
Description : Which alkyne yields propanoic acid as the only product upon treatment with ozone followed by hydrolysis? (a) 1-Butyne (b) 2-Hexyne (c) 1-Pentyne (d) 3-Hexyne
Last Answer : 3-Hexyne
Description : Ozonolysis of 2-butyne gives (a) Formic acid (b) Propanoic acid (c) Acetic acid (d) Butanoic acid
Last Answer : Acetic acid
Description : Which of the following compounds will be optically active? (a) Propanoic acid (b) 3-Chloropropanoic acid (c) 2-Chloropropanoic acid (d) 3-Chloropropene
Last Answer : 2-Chloropropanoic acid
Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY
Description : A molybdenum containing oxidase is (A) Cytochrome oxidase (B) Xanthine oxidase (C) Glucose oxidase (D) L-Amino acid oxidase
Description : Chemically, lipoic acid is (A) Saturated fatty acid (B) Unsaturated fatty acid (C) Amino acid (D) Sulphur containing fatty acid
Description : The amino acid containing hydroxy group: (A) Glycine (B) Isoleucine (C) Arginine (D) Thereonine
Description : The amino acid containing an indole ring: (A) Tryptophan (B) Arginine (C) Threonine (D) Phenylalanine
Description : The sulphur containing amino acid: (A) Homoserine (B) Serine (C) Methionine (D) Valine
Description : The amino acid containing hydroxyl group: (A) Alanine (B) Isoleucine (C) Arginine (D) Threonine
Description : An amino acid not containing the usual— COOH group is (A) Alanine (B) Tryptophan (C) Methionine (D) Taurine
Description : Sulphur-containing amino acid is (A) Glutathione (B) Chondroitin sulphate (C) Homocysteine (D) Tryptophan
Description : Sulphur containing amino acid is (A) Methionine (B) Leucine (C) Valine (D) Asparagine
Description : Amino acid containing a thio-ether bond is.
Last Answer : Methionine.
Last Answer : (A) Methionine
Description : Which of the following statements best describes the structure of waxes? (a) long-chain unsaturated carboxylic acids (b) long-chain saturated carboxylic acids (c) long-chain esters (d) short-chain esters
Last Answer : long-chain esters
Description : Fatty acids are (a) Unsaturated dicarboxylic acids (b) Long-chain alkanoic acids (c) Aromatic carboxylic acids (d) Aromatic dicarboxylic acids
Last Answer : Long-chain alkanoic acids
Description : Goitrogenic substance present in cabbage is (A) 5-vinyl-2 thio oxalzolidone (B) Pyridine-3-carboxylic acid (C) 3-Hydroxy-4, 5-dihydroxymethyl1–2-methyl pyridine (D) δ-ALA dehydratase
Description : Iodine value is used to estimate – (1) Hydroxyl groups in oil (2) Alkali, content in oil (3) Unsaturation in oil (4) Carboxylic groups in oil
Last Answer : (3) Unsaturation in oil Explanation: Iodine value is used to estimate unsatwation in oil.
Description : Iodine value is used to estimate (1) Hydroxyl groups in oil (2) Alkali content in oil (3) Unsaturation in oil (4) Carboxylic groups in oil
Last Answer : Unsaturation in oil
Description : In E. coli the chain initiating amino acid in protein synthesis is (A) N-formyl methionine(B) Methionine (C) Serine (D) Cysteine
Description : Maple syrup urine disease results from absence or serve deficiency of (A) Homogentisate oxidase (B) Phenylalanine hydroxylase (C) Branched chain amino acid transaminase (D) None of these