Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY
by

1 Answer

Answer :

Answer :  B
by
selected

Related questions

All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland (C) It is the precursor of ACTH and melatonin (D) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Description : All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland ... ) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

Whcih of the following hormone is a peptide of less than ten amino acids? (A) Insulin (B) Growth hormone (C) Oxytocin (D) Parathyroid hormone 228 MCQs IN BIOCHEMISTRY

Description : Whcih of the following hormone is a peptide of less than ten amino acids? (A) Insulin (B) Growth hormone (C) Oxytocin (D) Parathyroid hormone 228 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Cyclic AMP acts as the second messenger for all of the following except (A) Oxytocin (B) TSH (C) ACTH (D) FSH 216 MCQs IN BIOCHEMISTRY

Description : Cyclic AMP acts as the second messenger for all of the following except (A) Oxytocin (B) TSH (C) ACTH (D) FSH 216 MCQs IN BIOCHEMISTRY

Last Answer : Answer : A

TSH hormone biochemically is a (A) Protein (B) Fat (C) Glycoprotein (D) Carbohydrate 232 MCQs IN BIOCHEMISTRY

Description : TSH hormone biochemically is a (A) Protein (B) Fat (C) Glycoprotein (D) Carbohydrate 232 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Phosphorylated IRS-1 activates GRB-2 which is (A) G-protein receptor binding protein-2 (B) Growth factor receptor binding protein-2 (C) Growth hormone receptor binding protein-2 (D) Glucocorticoid receptor binding protein-2 226 MCQs IN BIOCHEMISTRY

Description : Phosphorylated IRS-1 activates GRB-2 which is (A) G-protein receptor binding protein-2 (B) Growth factor receptor binding protein-2 (C) Growth hormone receptor binding protein-2 (D) Glucocorticoid receptor binding protein-2 226 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

A 55-year-old male undergoes a total abdominal colectomy. Which of the following statement(s) is/are true concerning the hormonal response to the surgical procedure? a. Adrenocorticotropic hormone (ACTH) is secreted from the anterior pituitary gland b. ACTH stimulation results in elevation of serum cortisol levels for up to a week after the operation c. An increased secretion of aldosterone and ADH may contribute to postoperative fluid retention d. An increase in serum insulin and a fall in glucagon accelerate hepatic glucose production and maintain gluconeogenesis

Description : A 55-year-old male undergoes a total abdominal colectomy. Which of the following statement(s) is/are true concerning the hormonal response to the surgical procedure? a. Adrenocorticotropic ... in serum insulin and a fall in glucagon accelerate hepatic glucose production and maintain gluconeogenesis

Last Answer : Answer: a, c One of the earliest consequence of a surgical procedure is the rise in levels of circulating cortisol that occur in response to a sudden outpouring of ACTH ... hepatic glucose production, and, with other hormones (epinephrine and glucocorticoids), gluconeogenesis is maintained

True statements concerning hypoadrenal shock include which of the following? A. Adrenocortical insufficiency may manifest itself as severe shock refractory to volume and pressor therapy. B. The presence of hyperglycemia and hypotension may suggest the diagnosis of shock due to adrenocortical insufficiency. C. Hydrocortisone does not interfere with the serum cortisol assay and should be given to hemodynamically unstable patients suspected of having hypoadrenal shock. D. The rapid adrenocorticotropic hormone (ACTH) stimulation test should be performed to help establish the diagnosis of acute adrenocortical insufficiency.

Description : True statements concerning hypoadrenal shock include which of the following? A. Adrenocortical insufficiency may manifest itself as severe shock refractory to volume and pressor therapy. B. ... test should be performed to help establish the diagnosis of acute adrenocortical insufficiency.

Last Answer : Answer: AD DISCUSSION: Shock due to acute adrenocortical insufficiency is relatively uncommon but must be considered when shock refractory to volume replacement and pressor therapy is present. ... and it is the corticosteroid of choice while the ACTH stimulation test is being performed

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

Adrenalin is synthesized from (A) Adenine (B) Adenosine (C) Tyrosine (D) Tryptophan 230 MCQs IN BIOCHEMISTRY

Description : Adrenalin is synthesized from (A) Adenine (B) Adenosine (C) Tyrosine (D) Tryptophan 230 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Mineralocorticoids increase the tubular reabsorption of (A) Sodium and calcium (B) Sodium and potassium (C) Sodium and chloride (D) Potassium and chloride 224 MCQs IN BIOCHEMISTRY

Description : Mineralocorticoids increase the tubular reabsorption of (A) Sodium and calcium (B) Sodium and potassium (C) Sodium and chloride (D) Potassium and chloride 224 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Tyrosine is required for the synthesis of all of the following except (A) Melatonin (B) Epinephrine (C) Norepinephrine (D) Thyroxine 222 MCQs IN BIOCHEMISTRY

Description : Tyrosine is required for the synthesis of all of the following except (A) Melatonin (B) Epinephrine (C) Norepinephrine (D) Thyroxine 222 MCQs IN BIOCHEMISTRY

Last Answer : Answer : A

Secretion of thyroid hormones is regulated by (A) Hypothalamus (B) Anterior pituitary (C) Feedback regulation (D) All of these 220 MCQs IN BIOCHEMISTRY

Description : Secretion of thyroid hormones is regulated by (A) Hypothalamus (B) Anterior pituitary (C) Feedback regulation (D) All of these 220 MCQs IN BIOCHEMISTRY

Last Answer : Answer : D

Normal serum free testosterone in adult men varies between (A) 1–5 ng/dl (B) 6–9 ng/dl (C) 10–30 ng/dl (D) 50–100 ng/dl 214 MCQs IN BIOCHEMISTRY

Description : Normal serum free testosterone in adult men varies between (A) 1–5 ng/dl (B) 6–9 ng/dl (C) 10–30 ng/dl (D) 50–100 ng/dl 214 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Calcitonin causes (A) Calcinuria and phosphaturia (B) Decrease in urinary calcium (C) Decrease in urinary phosphorous (D) Increase in blood calcium level 212 MCQs IN BIOCHEMISTRY

Description : Calcitonin causes (A) Calcinuria and phosphaturia (B) Decrease in urinary calcium (C) Decrease in urinary phosphorous (D) Increase in blood calcium level 212 MCQs IN BIOCHEMISTRY

Last Answer : Answer : A

ADH (A) Reabsorbs water from renal tubules (B) Excretes water from renal tubules (C) Excretes hypotonic urine (D) Causes low specific gravity of urine 210 MCQs IN BIOCHEMISTRY

Description : ADH (A) Reabsorbs water from renal tubules (B) Excretes water from renal tubules (C) Excretes hypotonic urine (D) Causes low specific gravity of urine 210 MCQs IN BIOCHEMISTRY

Last Answer : Answer : A

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

A hormone secreted from posterior pituitary is (A) Vasopressin (B) Thyrotropic hormone (C) Prolactin (D) Adrenocorticotropic hormone CHAPTER 8 CHAPTER 8 HORMONE METABOLISM ABOLISM

Description : A hormone secreted from posterior pituitary is (A) Vasopressin (B) Thyrotropic hormone (C) Prolactin (D) Adrenocorticotropic hormone CHAPTER 8 CHAPTER 8 HORMONE METABOLISM ABOLISM

Last Answer : Answer : A

Hormone that binds to intracellular receptor is (A) Adrenocorticotropic hormone (B) Thyroxine (C) Follicle stimulating hormone (D) Glucagon

Description : Hormone that binds to intracellular receptor is (A) Adrenocorticotropic hormone (B) Thyroxine (C) Follicle stimulating hormone (D) Glucagon

Last Answer : Answer : B

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Biological activity of ACTH requires (A) 10-N-terminal amino acid (B) 24-N-terminal amino acid (C) 24-C-terminal amino acid (D) 15-C-terminal amino acid

Description : Biological activity of ACTH requires (A) 10-N-terminal amino acid (B) 24-N-terminal amino acid (C) 24-C-terminal amino acid (D) 15-C-terminal amino acid

Last Answer : Answer : B

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Description : 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Last Answer : 22

What is the function of adrenocorticotropic hormone? -Biology

Description : What is the function of adrenocorticotropic hormone? -Biology

Last Answer : answer:

Which hormone causes acromegaly if present in abnormally high concentrations in an adult? A) growth hormone B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Description : Which hormone causes acromegaly if present in abnormally high concentrations in an adult? A) growth hormone B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Last Answer : A) growth hormone

Which hormone stimulates the production of estrogen and progesterone? A) growth hormone B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Description : Which hormone stimulates the production of estrogen and progesterone? A) growth hormone B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Last Answer : C) gonadotropic hormones

Which hormone stimulates the production of cortisol? A) growth hormone B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Description : Which hormone stimulates the production of cortisol? A) growth hormone B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Last Answer : E) adrenocorticotropic hormone

The part of the brain controlling the anterior pituitary gland secretions is the A) medulla. B) thalamus. C) cerebral cortex. D) hypothalamus. E) cerebellum. Answer: D 21. Which of the following hormones is/are NOT a product of the anterior lobe of the pituitary? A) growth hormone B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Description : The part of the brain controlling the anterior pituitary gland secretions is the A) medulla. B) thalamus. C) cerebral cortex. D) hypothalamus. E) cerebellum. Answer: D ... B) antidiuretic hormone C) gonadotropic hormones D) thyroid-stimulating hormone E) adrenocorticotropic hormone

Last Answer : B) thalamus.

16.20 Adrenocorticotropic hormone is primarily used for: A. Treatment of Addison’s disease B. Treatment of congenital adrenal hyperplasia C. Treatment of autoimmune diseases D. Diagnosis of pituitary-adrenal axis disorders

Description : 16.20 Adrenocorticotropic hormone is primarily used for: A. Treatment of Addison’s disease B. Treatment of congenital adrenal hyperplasia C. Treatment of autoimmune diseases D. Diagnosis of pituitary-adrenal axis disorders

Last Answer : D. Diagnosis of pituitary-adrenal axis disorders

A project has the following cash inflows Rs.34,444; Rs.39,877; Rs.25,000; and Rs.52,800 for years 1 through 4, respectively. The initial cash outflow is Rs.104,000. Which of the following four statements is correct concerning the project internal rate of return (IRR)? A. The IRR is less than 10%. B. The IRR is greater than or equal to 10%, but less than 14%. C. The IRR is greater than or equal to 14%, but less than 18%. D. The IRR is greater than or equal to 18%.

Description : A project has the following cash inflows Rs.34,444; Rs.39,877; Rs.25,000; and Rs.52,800 for years 1 through 4, respectively. The initial cash outflow is Rs.104,000. Which of the following four statements ... than or equal to 14%, but less than 18%. D. The IRR is greater than or equal to 18%.

Last Answer : C. The IRR is greater than or equal to 14%, but less than 18%.

To the nearest rupee, what is the net present value of a replacement project whose cash flows are -Rs.104,000; Rs.34,444; Rs.39,877; Rs.25,000; and Rs.52,800 for years 0 through 4, respectively? The firm has decided to assume that the appropriate cost of capital is 10% and the appropriate risk-free rate is 6%. A. Rs.15,115 B. Rs.26,798 C. Rs.33,346 D. Rs.48,121

Description : To the nearest rupee, what is the net present value of a replacement project whose cash flows are -Rs.104,000; Rs.34,444; Rs.39,877; Rs.25,000; and Rs.52,800 for years 0 through 4, respectively? The firm has decided to ... -free rate is 6%. A. Rs.15,115 B. Rs.26,798 C. Rs.33,346 D. Rs.48,121

Last Answer : C. Rs.33,346

The staff reading at a distance of 80 m from a level with the bubble at its centre is 1.31 m. When the bubble is moved by 5 divisions out of the centre, the reading is 1.39 m. The angular value of the one division of the bubble, is (A) 28.8 sec (B) 41.25 sec (C) 14.52 sec (D) 25.05

Description : The staff reading at a distance of 80 m from a level with the bubble at its centre is 1.31 m. When the bubble is moved by 5 divisions out of the centre, the reading is 1.39 m. The angular value of the one division of the bubble, is (A) 28.8 sec (B) 41.25 sec (C) 14.52 sec (D) 25.05

Last Answer : (B) 41.25 sec

Body water is regulated by the hormone: (A) Oxytocin (B) ACTH (C) FSH (D) Epinephrine

Description : Body water is regulated by the hormone: (A) Oxytocin (B) ACTH (C) FSH (D) Epinephrine

Last Answer : Answer : A

Which of the following hormones is not involved in carbohydrate metabolism? (A) ACTH (B) Glucagon (C) Vasopressin (D) Growth hormone

Description : Which of the following hormones is not involved in carbohydrate metabolism? (A) ACTH (B) Glucagon (C) Vasopressin (D) Growth hormone

Last Answer : Answer : C

Gastric Secretion is regulated by the hormone: (A) Glucagon (B) Gastrin (C) Epinephrin (D) ACTH

Description : Gastric Secretion is regulated by the hormone: (A) Glucagon (B) Gastrin (C) Epinephrin (D) ACTH

Last Answer : Answer : B

Which of the following hormone is not under the control of ACTH? (A) Aldosterone (B) Cortisol (C) Corticosterone (D) Deoxycorticosterone

Description : Which of the following hormone is not under the control of ACTH? (A) Aldosterone (B) Cortisol (C) Corticosterone (D) Deoxycorticosterone

Last Answer : Answer : A

Which one of the following is not liberated by the adenohypophysis? (A) Growth hormone (B) TSH (C) ACTH (D) Gonadotropin

Description : Which one of the following is not liberated by the adenohypophysis? (A) Growth hormone (B) TSH (C) ACTH (D) Gonadotropin

Last Answer : Answer : D

Secretion of androgens is increased by (A) LH (B) FSH (C) ACTH (D) Growth hormone

Description : Secretion of androgens is increased by (A) LH (B) FSH (C) ACTH (D) Growth hormone

Last Answer : Answer : A

Acromegaly results from overproduction of (A) ACTH during childhood (B) TSH during adult life (C) Growth hormone during childhood (D) Growth hormone during adult life HORMONE METABOLISM 219

Description : Acromegaly results from overproduction of (A) ACTH during childhood (B) TSH during adult life (C) Growth hormone during childhood (D) Growth hormone during adult life HORMONE METABOLISM 219

Last Answer : Answer : D

Regulation of ACTH secretion occurs through (A) Corticotropin releasing hormone (CRH) and corticotropin release inhibiting hormone (CRIH) of hypothalamus (B) Feedback inhibition by cortisol (C) CRH and feedback inhibition by cortisol (D) CRIH and feedback inhibition by cortisol

Description : Regulation of ACTH secretion occurs through (A) Corticotropin releasing hormone (CRH) and corticotropin release inhibiting hormone (CRIH) of hypothalamus (B) Feedback inhibition by cortisol (C) CRH and feedback inhibition by cortisol (D) CRIH and feedback inhibition by cortisol

Last Answer : Answer : C

All the following statements about ACTH are true except (A) It is a tropic hormone (B) Its target cells are located in adrenal cortex (C) Its receptors are located in the cell membrane (D) Its second messenger is inositol triphosphate

Description : All the following statements about ACTH are true except (A) It is a tropic hormone (B) Its target cells are located in adrenal cortex (C) Its receptors are located in the cell membrane (D) Its second messenger is inositol triphosphate

Last Answer : Answer : D

A nonapeptide among the following is (A) Antidiuretic hormone (B) Insulin (C) ACTH (D) Thyrotropin releasing hormone

Description : A nonapeptide among the following is (A) Antidiuretic hormone (B) Insulin (C) ACTH (D) Thyrotropin releasing hormone

Last Answer : Answer : A