hich is the substance which can act both as an acid and a base?

hich is the substance which can act both as an acid and
a base?
by

1 Answer

Answer :

Amphoteric
by

Related questions

Which is the substance which can act both as an acid and a base? -Do You Know?

Description : Which is the substance which can act both as an acid and a base? -Do You Know?

Last Answer : answer:

Which is the substance which can act both as an acid and a base?

Description : Which is the substance which can act both as an acid and a base?

Last Answer : Amphoteric

hich of the following statements is correct? (a) All metals are ductile. -Science

Description : hich of the following statements is correct? (a) All metals are ductile. -Science

Last Answer : Answer is (c) Generally, metals are ductile.

hich section is the remaining part of a process’s code: a. Racing section b. Critical section Cc. Entry section d. Reminder secti

Description : hich section is the remaining part of a process’s code: a. Racing section b. Critical section Cc. Entry section d. Reminder secti

Last Answer : b. Entry section

hich of the following is the most suitable abrasive for grinding high tensile strength materials? (A) Silicon carbide (B) Corundum (C) Aluminium oxide (D) Boron carbide

Description : hich of the following is the most suitable abrasive for grinding high tensile strength materials? (A) Silicon carbide (B) Corundum (C) Aluminium oxide (D) Boron carbide

Last Answer : Option C

hich following organs convert glycogen into glucose and purifier blood.

Description : hich following organs convert glycogen into glucose and purifier blood.

Last Answer : Liver

hich exchange-rate system involves a “leaning against the wind” strategy in which short-term fluctuations in exchange rates are reduced without adhering to any particular exchange rate over the long run? A. Pegged or fixed exchange rates B. Adjustable pegged exchange rates C. Managed floating exchange rates D. Freely floating exchange rates

Description : hich exchange-rate system involves a leaning against the wind strategy in which short-term fluctuations in exchange rates are reduced without adhering to any particular exchange rate over ... Adjustable pegged exchange rates C. Managed floating exchange rates D. Freely floating exchange rates

Last Answer : C. Managed floating exchange rates

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

hich of the following burst is used to broadcast the frequency and time synchronization control messages? a) FCCH and SCH b) TCH and DCCH c) RACH and TCH d) FCCH and DCCH

Description : hich of the following burst is used to broadcast the frequency and time synchronization control messages? a) FCCH and SCH b) TCH and DCCH c) RACH and TCH d) FCCH and DCCH

Last Answer : a) FCCH and SCH

hich is the less toxic herbicide? a). Atrazine b). 2,4-D c). Simazine d). All of these

Description : hich is the less toxic herbicide? a). Atrazine b). 2,4-D c). Simazine d). All of these

Last Answer : d). All of these

hich one out of these is not a data link layer technology:- a) Bluetooth b) UART c) WiFi d) HTTP

Description : hich one out of these is not a data link layer technology:- a) Bluetooth b) UART c) WiFi d) HTTP

Last Answer : d) HTTP

hich is not the commonly used programming language for AI? ⮚ PROLOG ⮚ LISP ⮚ Perl ⮚ Java script

Description : hich is not the commonly used programming language for AI? ⮚ PROLOG ⮚ LISP ⮚ Perl ⮚ Java script

Last Answer : ⮚ Perl

A substance which participates readily in both acid-base and oxidation-reduction reactions is:

Description : A substance which participates readily in both acid-base and oxidation-reduction reactions is:

Last Answer : A substance which participates readily in both acid-base and oxidation-reduction reactions is: A. `Na_(2) CO_(3)` B ... KMnO_(4)` D. `H_(2)C_(2)O_(4)`

A substance that accepts an electron pair is classified as a: w) bronsted-lowry acid x) bronsted-lowry base y) lewis acid z) lewis base

Description : A substance that accepts an electron pair is classified as a: w) bronsted-lowry acid x) bronsted-lowry base y) lewis acid z) lewis base

Last Answer : ANSWER: Y -- LEWIS ACID

22. \( H _{2} O \) can act either as an acid or base. Which of the following reaction best illustrate the behaviour of water as a base?(a) \( H _{2} O + NH _{3} \rightarrow OH ^{+}+ NH _{4}^{-} \)(b) \( H _{2} O + NH _{2} \rightarrow NH _{3}+ OH ^{-} \)(c) \( HCl + H _{2} O \rightarrow H _{3} O ^{+}+ Cl ^{-} \)(d) \( HCl + NaOH \rightarrow NaCl + H _{2} O \)

Description : 22. \( H _{2} O \) can act either as an acid or base. Which of the following reaction best illustrate the behaviour of water as a base?(a) \( H _{2} O + NH _{3} \rightarrow OH ^{+}+ NH _{4}^{-} \)(b) \( H _{ ... O \rightarrow H _{3} O ^{+}+ Cl ^{-} \)(d) \( HCl + NaOH \rightarrow NaCl + H _{2} O \)

Last Answer : 22. \( H _{2} O \) can act either as an acid or base. Which of the following reaction best illustrate ... HCl + NaOH \rightarrow NaCl + H _{2} O \)

Give an example of a chemical substance which can act both as an antiseptic and disinfectant.

Description : Give an example of a chemical substance which can act both as an antiseptic and disinfectant.

Last Answer : Ans. Phenol. 

white fuzzy sticky substance at bud base causes bud drop, cure?

Description : white fuzzy sticky substance at bud base causes bud drop, cure?

Last Answer : Need Answer

An unknown substance (P) functions as weak base in water. It produces silver mirror test. It reacts with dilute `HCl` to produce (Q) which turns blue

Description : An unknown substance (P) functions as weak base in water. It produces silver mirror test. It reacts with dilute `HCl` to produce (Q) which turns blue

Last Answer : An unknown substance (P) functions as weak base in water. It produces silver mirror test. It reacts with dilute `HCl` ... ` C. `NH_(2)OH` D. `HPO_(3)`

An unknown substance (P) functions as weak base in water. It produces silver mirror test. It reacts with dilute `HCl` to produce (Q) which turns blue

Description : An unknown substance (P) functions as weak base in water. It produces silver mirror test. It reacts with dilute `HCl` to produce (Q) which turns blue

Last Answer : An unknown substance (P) functions as weak base in water. It produces silver mirror test. It reacts with dilute `HCl` ... ` C. `NH_(2)OH` D. `HPO_(3)`

A volatile substance added to a paint to make its application easy and smooth, is known as (A) Base (B) Solvent (C) Vehicle (D) None to these

Description : A volatile substance added to a paint to make its application easy and smooth, is known as (A) Base (B) Solvent (C) Vehicle (D) None to these

Last Answer : Answer: Option B

Which of the following statement(s) with regard to an abstract class in JAVA is/are TRUE? I. An abstract class is one that is not used to create objects. II. An abstract class is designed only to act as a base class to be inherited by other classes. (1) Only l (2) Only II (3) Neither I nor II (4) Both l and II

Description : Which of the following statement(s) with regard to an abstract class in JAVA is/are TRUE? I. An abstract class is one that is not used to create objects. II. An abstract class is designed only to act as a base class ... by other classes. (1) Only l (2) Only II (3) Neither I nor II (4) Both l and II

Last Answer : Both l and II

Streptokinase is a substance used in the treatment of acute myocardial infarction. How does this substance act?

Description : Streptokinase is a substance used in the treatment of acute myocardial infarction. How does this substance act?

Last Answer : Substances known as fibrinolytics, like streptokinase and urokinase, can destroy thrombi (clots formed inside blood vessels, capillaries or within the heart chambers) and are used in the treatment ... comes after the bacteria that produce it, the streptococci. Learn the Concept of Homeostasis Here

What is dicoumarol? How does this substance act in the clotting process and what are some examples of its toxicity?

Description : What is dicoumarol? How does this substance act in the clotting process and what are some examples of its toxicity?

Last Answer : Dicoumarol is an anticoagulant drug. Due to its molecular structure dicoumarol competes with vitamin K for the binding to substrates blocking the formation of clotting factors and interrupting ... administered during pregnancy since they pass the placental barrier and can cause fetal hemorrhages.

Adherent mucoid alkaline substance covering the inner lining of stomach is to - (1) digest starch (2) act against bacteria (3) prevent the action of pepsin of mucosa (4) prevent viral infection

Description : Adherent mucoid alkaline substance covering the inner lining of stomach is to - (1) digest starch (2) act against bacteria (3) prevent the action of pepsin of mucosa (4) prevent viral infection

Last Answer : (3) prevent the action of pepsin of mucosa Explanation: The continuous adherent mucus layer is also a barrier to luminal pepsin, thereby protecting the underlying mucosa from proteolytic ... support surface neutralization of acid and act as a protective physical barrier against luminal pepsin.

1. Who has written the book ‘My Frozen Turbulence in Kashmir’? 2. Which substance is more than 80% in the cell? 3. Which language is Next to Hindi spoken by the largest number of people in the Indian subcontinent? 4. Which planet have thirteen moons? 5. Which was the chariler Act to close the trade of East India?

Description : 1. Who has written the book My Frozen Turbulence in Kashmir'? 2. Which substance is more than 80% in the cell? 3. Which language is Next to Hindi spoken by the largest number of people in ... 19. What is Water vapour beyond the dew point? 20. When did the concept of pollution emerge clearly?

Last Answer : Answer : 1. Jagmohan 2. Water 3. Bengali 4. Neptune 5. 1833 6. Ceramic oxides 7. International Year of the Family 8. Karl Marx 9. 50 miles 10. Neolithic 11. Nagpur 12. Directive Principles 13 ... equator 15. Clearing jungles 16. Squash 17. Cycling 18. Pb 19. Condensation 20. In the Post-Vedic period

Adherent mucoid alkaline substance covering the inner lining of stomach is to : (1) digest starch (2) act against bacteria (3) prevent the action of pepsin of mucosa (4) prevent viral infection

Description : Adherent mucoid alkaline substance covering the inner lining of stomach is to : (1) digest starch (2) act against bacteria (3) prevent the action of pepsin of mucosa (4) prevent viral infection

Last Answer : prevent the action of pepsin of mucosa