Description : Which of the following statements about the physical properties of metal is not correct? (a) All metals are solid except mercury (b) Most metals are hard except sodium and potassium (c) Metals are not malleable (d) Most metals are ductile
Last Answer : Ans:(c)
Description : (3) reflection of light due to the presence of free electrons Explanation: Lustre (or luster) is the way light interacts with the surface of a crystal, rock, or mineral. The word ... conductivity, and high density. Typically they are malleable and ductile, deforming -under stress without cleaving.
Last Answer : Cloud is a colloidal dispersion of – (1) Air in a dispersion medium of water (2) Fog in a dispersion medium of water (3) Mist in a dispersion medium of air (4) Water drops in a dispersion medium of air
Description : Strong and ductile materials (a) Polymers (b) Ceramics (c) Metals (d) Semiconductors
Last Answer : (c) Metals
Description : Figure out the odd statement about ceramics in the following (a) Good insulators of heat and electricity (b) Usually less desire than metals (c) Ductile in nature (d) Contains both metallic and nonmetallic elements
Last Answer : (c) Ductile in nature
Description : hich section is the remaining part of a process’s code: a. Racing section b. Critical section Cc. Entry section d. Reminder secti
Last Answer : b. Entry section
Description : hich of the following is the most suitable abrasive for grinding high tensile strength materials? (A) Silicon carbide (B) Corundum (C) Aluminium oxide (D) Boron carbide
Last Answer : Option C
Description : hich is the substance which can act both as an acid and a base?
Last Answer : Amphoteric
Description : hich following organs convert glycogen into glucose and purifier blood.
Last Answer : Liver
Description : hich exchange-rate system involves a leaning against the wind strategy in which short-term fluctuations in exchange rates are reduced without adhering to any particular exchange rate over ... Adjustable pegged exchange rates C. Managed floating exchange rates D. Freely floating exchange rates
Last Answer : C. Managed floating exchange rates
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : hich of the following burst is used to broadcast the frequency and time synchronization control messages? a) FCCH and SCH b) TCH and DCCH c) RACH and TCH d) FCCH and DCCH
Last Answer : a) FCCH and SCH
Description : hich is the less toxic herbicide? a). Atrazine b). 2,4-D c). Simazine d). All of these
Last Answer : d). All of these
Description : hich one out of these is not a data link layer technology:- a) Bluetooth b) UART c) WiFi d) HTTP
Last Answer : d) HTTP
Description : hich is not the commonly used programming language for AI? ⮚ PROLOG ⮚ LISP ⮚ Perl ⮚ Java script
Last Answer : ⮚ Perl
Description : Pick up the correct statement from the following: (A) A ductile material has large plastic zone (B) A brittle material has no plastic zone (C) A rigid material has no plastic zone (D) All the above
Last Answer : All the above
Description : Consider the following statements: 1. when an electric bulb is switched on, the resistance of its tungsten filament increases. 2. the resistance of pure metals increases on heating. Which of the above statements is/are correct? (a) Both 1 and 2 (b) only 1 (c) only 2 (d) Neither 1 nor 2
Last Answer : Ans:(a)
Description : Consider the following statements: 1. Mercury metal exists as a liquid at room temperature. 2. The property of metals by which they can be beaten into thin sheets is called malleability 3. Neutral fats such as butter and vegetable oils ... b) 1, 3 and 4 only (c) 2, 3 and 4 only (d) 1, 2 and 3 only
Last Answer : Ans:(d)
Description : Which one of the following statements concerning elements in the Periodic Table is correct? A Elements of the same group all have the same number of electrons in the outermost occupied electron shell. B ... (Group 17) are all gases at room temperature. E The Group 13 elements are all metals.
Last Answer : D) Are compounds that exhibit both metallic & non-metallic properties to some extent and are exemplified by elements like germanium, silicon & boron
Description : Which material is very hard and very ductile? -General Knowledge
Last Answer : The answer is 'Nichrome'
Last Answer : answer:
Description : Which formation of iron is least ductile?
Last Answer : Which formation of iron is least ductile? A. Hard steel B. Cast iron C. Mild steel D. Wrought iron
Description : What type of solid is ductile and malleable?
Last Answer : Several metals are ductile and malleable.
Description : Are covalent molecular compounds ductile?
Last Answer : What is the answer ?
Description : If a metal can be drawn into wires relatively easily it is called: (1) malleable (2) ductile (3) extractive (4) tactile
Last Answer : (2) ductile Explanation: Ductility is a physical property of a material associated with the ability to be hammered thin or stretched into wire without breaking.
Description : 'Shock-absorbers are usually made of steel as it – (1) is not brittle (2) has lower elasticity (3) has higher elasticity (4) has no ductile property
Last Answer : (3) has higher elasticity Explanation: A shock absorber is a mechanical device designed to smooth out or damp shock impulse, and dissipate kinetic energy. Steel is an alloy made by combining iron and other elements, the most common of these being carbon.
Description : Which theories of failure are used for (a) ductile materials, and (B) brittle materials ?
Last Answer : For ductile materials, theories of failure used are maximum shear stress theory, and maximum energy of distortion theory; while for brittle materials, theory of maximum principal stress, and maximum strain are used.
Description : List at least two factors that promote transition from ductile to brittle fracture.
Last Answer : Manner of loading, and the rate of loading promote transition from ductile to brittle frac¬ture. A machine member may have ductile failure under static loading but may fail in brittle fashion when the ... testing speed but if load is applied at a high velocity then failure may be brittle.
Description : Which material is very hard and very ductile?
Last Answer : Nichrome
Description : Polystyrene is a __________ plastic at room temperature. (A) Ductile (B) Brittle (C) Malleable (D) None of these
Last Answer : (B) Brittle
Description : Thorium metal (A) Resembles steel in appearance (B) Is less hard (in the range of silver) (C) Is highly ductile (D) All (A), (B) and (C
Last Answer : (D) All (A), (B) and (C
Description : Zinc is highly __________ at room temperature. (A) Ductile (B) Resistant to atmospheric corrosion (C) Malleable (D) Brittle
Last Answer : (B) Resistant to atmospheric corrosion
Description : A material capable of undergoing large permanent deformation, when subjected to compression is termed as (A) Malleable (B) Ductile (C) Brittle (D) None of these
Last Answer : (A) Malleable
Description : Materials having __________ lattice structure are usually most ductile. (A) FCC (B) BCC (C) HCP (D) Cubic
Last Answer : (A) FCC
Description : Wrought iron is (A) High carbon iron (B) Highly resistance to acid corrosion (C) Malleable & ductile; and hence is used for chain links, hooks & couplings (D) An alloy of iron, chromium & carbon
Last Answer : (C) Malleable & ductile; and hence is used for chain links, hooks & couplings
Description : Pick out the wrong statement. (A) Metal/alloys having hexagonal crystal lattice structure are less malleable than those having cubic crystal lattice structure (B) Metal/alloys having body centred cubic ... D) Both ferritic & austenitic stainless steel has a face centred cubic (fcc) crystal structure
Last Answer : (C) Tungsten has a body centred cubic (bcc) crystal lattice structure
Description : Cast iron is a __________ material. (A) Brittle (B) Ductile (C) Tough (D) Malleable
Last Answer : (A) Brittle
Description : A material is called 'ductile', if it can be (A) Drawn into wires (B) Hammered to a thin sheet (C) Fractured without deformation (D) Made lustrous by heating it
Last Answer : (A) Drawn into wires
Description : . A material capable of undergoing large permanent deformation, when subjected to tension is termed as (A) Friable (B) Ductile (C) Brittle (D) None of these
Last Answer : (B) Ductile
Description : Ferric stainless steels compared to austenitic stainless steels (A) Have lower corrosion resistance (B) Are harder to fabricate (C) Are less ductile and hence less suitable for cold pressing (D) All (A), (B) and (C)
Last Answer : (D) All (A), (B) and (C)
Description : Substances that elongate considerably and undergo plastic deformation before they break are known as A. brittle substances B. breakable substances C. ductile substances D. elastic substances
Last Answer : ductile substances
Description : Distortion energy theorem is not recommended for ductile materials. a) True b) False
Last Answer : b) False
Description : In the Haig-Soderberg diagram, the test data for ductile material falls near the ______________ a) Soderberg line b) Goodman Line c) Gerber line d) Haig line
Last Answer : c) Gerber line
Description : In which of the following case stress concentration factor is ignored? a) Ductile material under static load b) Ductile material under fluctuating load c) Brittle material under static load
Last Answer : a) Ductile material under static load
Description : In a ductile material, the strength are (a)Firstly Ultimate >yield > elastic limit (b) Secondly Ultimate > yield =elastic limit (c) Thirdly Ultimate=yield=elastic limit (d) None
Last Answer : (a)Firstly Ultimate >yield > elastic limit
Description : Theories of elastic failure while dealing with ductile materials consider the failure criterion as (a) Ultimate stress (b) Yield stress (c) Both ultimate and yield stress (d) None
Last Answer : (b) Yield stress
Description : A ductile material may not meet a failure if it has been tested for the theories of failure (a) Firstly Maximum Shear Stress Theory (b) Secondly Maximum Shear Strain Energy Theory (c) Both (a) & (b) (d) None
Last Answer : (c) Both (a) & (b)
Description : A ductile material may not meet a failure if it has been tested for the theories of failure (a) Firstly Maximum Principal Theory (b) Secondly Maximum Principal Strain Theory (c) Thirdly Maximum principal strain energy theory (d) None
Last Answer : (d) None
Description : Maximum total strain energy theory is applicable to (a) Ductile materials (b) Brittle materials (c) Composite materials (d) None
Last Answer : (a) Ductile materials
Last Answer : (b) Brittle materials