The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

The primary structure of a protein refers to :
(a) whether the protein is fibrous or globular
(b) the amino acid sequence in the polypeptide chain
(c) the orientation of the amino acid side chains in space
(d) the presence or absence of an α-helix
by

1 Answer

Answer :

the amino acid sequence in the polypeptide chain
by

Related questions

Which of the following is the “quaternary structure” of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with respect to each other (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Description : Which of the following is the quaternary structure of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with ... (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Last Answer : description of the way the peptide chains are arranged with respect to each other

The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?

Description : The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?

Last Answer : beads of different colors joined together on a piece of string

At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

In protein structure the α-helix and βpleated sheets are example of (A) Primary structure (B) Secondary structure (C) Tertiary structure (D) Quaternary structure

Description : In protein structure the α-helix and βpleated sheets are example of (A) Primary structure (B) Secondary structure (C) Tertiary structure (D) Quaternary structure

Last Answer : Answer : B

Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Description : Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Last Answer : Answer : A

Collagen is (a) fibrous protein (b) globular protein (c) lipid (d) carbohydrate.

Description : Collagen is (a) fibrous protein (b) globular protein (c) lipid (d) carbohydrate.

Last Answer : (a) fibrous protein

A coiled structure in which peptide bonds are folded in regular manner by (A) Globular proteins (B) Fibrous proteins (C) Both (A) and (B) (D) None of these

Description : A coiled structure in which peptide bonds are folded in regular manner by (A) Globular proteins (B) Fibrous proteins (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

Which of the following may characterize the “secondary structure” of proteins? (a) conformation of the protein backbone (b) α-Helix (c) parallel β-pleated sheet (d) all of the above

Description : Which of the following may characterize the “secondary structure” of proteins? (a) conformation of the protein backbone (b) α-Helix (c) parallel β-pleated sheet (d) all of the above

Last Answer : all of the above

Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four heme groups. As a protein composed of association of polypeptide chains, the functionality of hemoglobin depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule

Description : Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four ... depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule

Last Answer : On average what is the life duration of the red blood cells?

The α-Helix is a common form of (a) Primary structure (b) Tertiary structure (c) Secondary structure (d) None of these

Description : The α-Helix is a common form of (a) Primary structure (b) Tertiary structure (c) Secondary structure (d) None of these

Last Answer : Secondary structure

Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Description : Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Last Answer : Answer : A

In proteins the α-helix and β-pleated sheet are examples of (A) Primary structure (B) Secondary structure (C) Tertiary structure (D) Quaternary structure

Description : In proteins the α-helix and β-pleated sheet are examples of (A) Primary structure (B) Secondary structure (C) Tertiary structure (D) Quaternary structure

Last Answer : Answer : B

An amino acid that does not take part in α helix formation is (A) Histidine (B) Tyrosine (C) Proline (D) Tryptophan

Description : An amino acid that does not take part in α helix formation is (A) Histidine (B) Tyrosine (C) Proline (D) Tryptophan

Last Answer : Answer : C

Along the α-helix each amino acid residue advances in nm by (A) 0.15 (B) 0.10 (C) 0.12 (D) 0.20

Description : Along the α-helix each amino acid residue advances in nm by (A) 0.15 (B) 0.10 (C) 0.12 (D) 0.20

Last Answer : Answer : A

Each turn of α-helix contains the amino acid residues (number): (A) 3.6 (B) 3.0 (C) 4.2 (D) 4.5

Description : Each turn of α-helix contains the amino acid residues (number): (A) 3.6 (B) 3.0 (C) 4.2 (D) 4.5

Last Answer : Answer : A

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Last Answer : Answer : B

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

Difference between fibrous proteins and globular proteins? -Biology

Description : Difference between fibrous proteins and globular proteins? -Biology

Last Answer : answer:

The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Description : The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Last Answer : a. primary

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide chains. Reason `:` Haemoglobin is a conjugate protein an

Description : Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide chains. Reason `:` Haemoglobin is a conjugate protein an

Last Answer : Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide ... False. D. If both Assertion & Reason are false.

α-helix is disrupted by certain amino acids like (A) Proline (B) Arginine (C) Histidine (D) Lysine

Description : α-helix is disrupted by certain amino acids like (A) Proline (B) Arginine (C) Histidine (D) Lysine

Last Answer : Answer : A

Each turn of α-helix contains the number of amino acids (A) 2.8 (B) 3.2 (C) 3.4 (D) 3.6

Description : Each turn of α-helix contains the number of amino acids (A) 2.8 (B) 3.2 (C) 3.4 (D) 3.6

Last Answer : Answer : D

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

Neoprene is rendered non-inflammable, because of (A) Its cross-linked structure (B) Its linear chain structure (C) The presence of chlorine atoms in its monomer (D) The absence of chlorine atoms in its monomer

Description : Neoprene is rendered non-inflammable, because of (A) Its cross-linked structure (B) Its linear chain structure (C) The presence of chlorine atoms in its monomer (D) The absence of chlorine atoms in its monomer

Last Answer : (C) The presence of chlorine atoms in its monomer

Which statement about hormone types is correct? A) Non-steroid hormones activate an enzyme cascade. B) Steroid hormones regulate the production of a particular protein. C) Non-steroid hormones are either amino acids, peptides, or proteins. D) Steroid hormones all have four carbon rings with different side chains. E) All of the choices are correct.

Description : Which statement about hormone types is correct? A) Non-steroid hormones activate an enzyme cascade. B) Steroid hormones regulate the production of a particular protein. C) Non-steroid hormones are ... all have four carbon rings with different side chains. E) All of the choices are correct.

Last Answer : E) All of the choices are correct.

In thalassemia, an amino acid is substituted in (A) Alpha chain (B) Beta chain (C) Alpha and beta chains (D) Any chain MINERAL METABOLISM 195

Description : In thalassemia, an amino acid is substituted in (A) Alpha chain (B) Beta chain (C) Alpha and beta chains (D) Any chain MINERAL METABOLISM 195

Last Answer : Answer : D

Sickle cell anaemia induce to (a) change of amino acid in a-chain of haemoglobin (b) change of amino acid in b-chain of haemoglobin (c) change of amino acid in both a and b chains of haemoglobin (d) change of amino acid either a or b chains of haemoglobin.

Description : Sickle cell anaemia induce to (a) change of amino acid in a-chain of haemoglobin (b) change of amino acid in b-chain of haemoglobin (c) change of amino acid in both a and b chains of haemoglobin (d) change of amino acid either a or b chains of haemoglobin.

Last Answer : (b) change of amino acid in b-chain of haemoglobin

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

.Expressed Sequence Tags (ESTs) refers to (a) novel DNA sequences (b) genes expressed as RNA (c) polypeptide expression (d) DNA polymorphism.

Description : .Expressed Sequence Tags (ESTs) refers to (a) novel DNA sequences (b) genes expressed as RNA (c) polypeptide expression (d) DNA polymorphism.

Last Answer : (b) genes expressed as RNA

What two primary factors determine whether or no molecular collision leads to a chemical reaction? w) energy and volume of molecules x) energy and mass of molecules y) energy and orientation of molecules z) orientation and volume of molecules

Description : What two primary factors determine whether or no molecular collision leads to a chemical reaction? w) energy and volume of molecules x) energy and mass of molecules y) energy and orientation of molecules z) orientation and volume of molecules

Last Answer : ANSWER: Y -- ENERGY AND ORIENTATION OF MOLECULES

Maple syrup urine disease results from absence or serve deficiency of (A) Homogentisate oxidase (B) Phenylalanine hydroxylase (C) Branched chain amino acid transaminase (D) None of these

Description : Maple syrup urine disease results from absence or serve deficiency of (A) Homogentisate oxidase (B) Phenylalanine hydroxylase (C) Branched chain amino acid transaminase (D) None of these

Last Answer : Answer : D

In glucose the orientation of the —H and —OH groups around the carbon atom 5 adjacent to the terminal primary alcohol carbon determines (A) D or L series (B) Dextro or levorotatory (C) α and β anomers (D) Epimers

Description : In glucose the orientation of the —H and —OH groups around the carbon atom 5 adjacent to the terminal primary alcohol carbon determines (A) D or L series (B) Dextro or levorotatory (C) α and β anomers (D) Epimers

Last Answer : A

When haemoglobin takes up oxygen there is a change in the structure due to the moving closer together of (A) β-chains (B) β-chains (C) γ-chains (D) α and γ chains

Description : When haemoglobin takes up oxygen there is a change in the structure due to the moving closer together of (A) β-chains (B) β-chains (C) γ-chains (D) α and γ chains

Last Answer : Answer : A

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges in the protein (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Description : Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges ... (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Last Answer : reducing the disulfide bridges in the protein

The structure of DNA is a double helix formed by two strands of DNA sequence. This sequence consists of 4 different nucleotides- Adenine, Thymine, Cytosine and Guanine. How do the nucleotides on one strand interact with the nucleotides on the second strand to maintain the helical shape of DNA?

Description : The structure of DNA is a double helix formed by two strands of DNA sequence. This sequence consists of 4 different nucleotides- Adenine, Thymine, Cytosine and Guanine. How do the nucleotides on one strand interact with the nucleotides on the second strand to maintain the helical shape of DNA?

Last Answer : Complementary Base Pairing. Adenine complementary base pairs with Thymine and Guanine complementary base pairs with Cytosine.

The a-helix of proteins is (A) A pleated structure (B) Made periodic by disulphide bridges (C) A non-periodic structure (D) Stabilised by hydrogen bonds between NH and CO groups of the main chain

Description : The a-helix of proteins is (A) A pleated structure (B) Made periodic by disulphide bridges (C) A non-periodic structure (D) Stabilised by hydrogen bonds between NH and CO groups of the main chain

Last Answer : Answer : C

The α-Helix is held in a coiled conformation partially because of : (a) Optical activity (b) Hydrogen bonding (c) Resonance (d) Delocalization

Description : The α-Helix is held in a coiled conformation partially because of : (a) Optical activity (b) Hydrogen bonding (c) Resonance (d) Delocalization

Last Answer : Hydrogen bonding

The number of polypeptide chains present in a molecule of haemoglobin is/are

Description : The number of polypeptide chains present in a molecule of haemoglobin is/are

Last Answer : The number of polypeptide chains present in a molecule of haemoglobin is/are A. 1 B. 3 C. 4 D. 2

When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Description : When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Last Answer : Answer : C

Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Description : Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Last Answer : Answer : B

The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Description : The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Last Answer : Answer : B