Description : Maple syrup urine disease results from absence or serve deficiency of (A) Homogentisate oxidase (B) Phenylalanine hydroxylase (C) Branched chain amino acid transaminase (D) None of these
Last Answer : Answer : D
Description : An inborn error, maple syrup urine disease is due to deficiency of the enzyme: (A) Isovaleryl-CoAhydrogenase (B) Phenylalnine hydroxylase (C) Adenosyl transferase (D) α-Ketoacid decarboxylase
Description : A modified amino acid solution with increased equimolar branched-chain amino acids and decreased aromatic amino acids has been proposed for patients with hepatic insufficiency. Which of the following ... D. In some studies of surgical patients, improvements in mortality have been reported.
Last Answer : Answer: D DISCUSSION: The use of modified amino acid solutions is based on the false neurotransmitter hypothesis of the cause of hepatic coma. According to this hypothesis, the imbalance ... in a group of patients with cirrhosis, decreasing morbidity and showing a trend toward decreased mortality
Description : Xanthoproteic test is positive in proteins containing (A) Sulphur amino acids (B) α-Amino acids (C) Aromatic amino acids (D) Aliphatic amino acids
Last Answer : Answer : C
Description : Fatty acids are (a) Unsaturated dicarboxylic acids (b) Long-chain alkanoic acids (c) Aromatic carboxylic acids (d) Aromatic dicarboxylic acids
Last Answer : Long-chain alkanoic acids
Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine
Description : All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine
Last Answer : Answer : B
Description : What are branched chain amino acids?
Last Answer : Valine, leucine and isoleucine.
Description : Which of the following statement(s) is/are true concerning metabolic derangements in sepsis and the systemic inflammatory response syndrome which may follow progressive shock? a. Alterations in glucose ... The serum aromatic amino acids fall rapidly as they are actively used in oxidative metabolism
Last Answer : Answer: b, c A broad spectrum of metabolic abnormalities become apparent in sepsis and the systemic inflammatory response syndrome following shock. Disruption of the normal cycles of carbohydrate, ... acetyl coenzyme A. This results in reduced serum level of leucine, isoleucine and valine
Description : Study the pedigree chart given below. What does it show? (a) Inheritance of a condition like phenylketonuria as an autosomal recessive trait. (b) The pedigree chart is wrong as this is ... disease like haemophilia. (d) Inheritance of a sex-linked inborn error of metabolism like phenylketonuria
Last Answer : (a) Inheritance of a condition like phenylketonuria as an autosomal recessive trait.
Description : Select the incorrect statement from the following. (a) Galactosemia is an inborn error of metabolism. (b) Small population size results in random genetic drift in a population. (c) Baldness is a sex-limited trait. (d) Linkage is an exception to the principle of independent assortment in heredity
Last Answer : (c) Baldness is a sex-limited trait.
Description : Which of the following methods can be used to increase the octane rating of gasoline? (a) Adding branched-chain alkanes (b) Adding tetraethyllead (c) Adding aromatic hydrocarbons (d) All of these
Last Answer : All of these
Description : Sulphur is made available to the body by the amino acids: (A) Cystine and methionine (B) Taurine and alanine (C) Proline and hydroxyproline (D) Arginine and lysine MINERAL METABOLISM 191
Last Answer : Answer : A
Description : The figure shows a hypothetical tetrapeptide portion of a protein with parts labelled A-D. Which one of the following options is correct? - HN - CH - CO - NH - CH - CO - NH - CH - CO - ... -terminal amino acid and D is N-terminal amino acid. (d) A is a sulphur containing amino acid methionine.
Last Answer : (a) D is the acidic amino acid-glutamic acid.
Description : Sulphur containing amino acids after catabolism produces a substance which is excreted: (A) SO2 (B) HNO3 (C) H2SO4 (D) H3PO4
Description : The third active process for amino acids transport involves (A) Acidic amino acids (B) Basic amino acids (C) Neutral amino acids (D) Sulphur containing amino acids
Description : All the following are sulphur containing amino acids found in proteins except (A) Cysteine (B) Cystine (C) Methionine (D) Threonine
Last Answer : (D) Threonine
Description : An important feature of maple syrup urine disease is (A) Patient can not be treated by dietary regulation (B) Without treatment death, of patient may occur by the end of second year of life (C) Blood levels of leucine, isoleucine and serine are increased (D) Excessive brain damage
Description : Maple syrup urine disease becomes evident in extra uterine life by the end of (A) First week (B) Second week (C) Third week (D) Fourth week
Description : Increased urinary indole acetic acid is diagnostic of (A) Maple syrup urine disease (B) Hartnup disease (C) Homocystinuia (D) Phenylketonuria
Description : In which of the following is mental retardation an expected finding? 1) Alkaptonuria 2) Cystinuria 3) Glycogen storage disease 4) Lactose intolerance 5) Maple syrup urine disease
Last Answer : Answers-5 MENTAL RETARDATION. Fragile X syndrome-commonest male cause. Hypoxia at birth, intaventricular haemorrhage, rhesus disease, Congenital infections - toxoplasmosis, CMV, rubella ... with diet. -homocystinuria, phenylketonuria -maple syrup urine disease, tryptophanuria -galactosaemia
Description : All of the following statements about aspartate are true except (A) It is non-essential amino acid (B) It is a dicarboxylic amino acid (C) It can be synthesized from pyruvate and glutamate (D) It can be converted into asparagine
Description : Pick out the wrong statement. (A) Linear polymers are formed from bifunctional groups only and are normally thermoplastic (B) Cross-linked branched chain polymers are either elastometric or ... (D) Dibasic acids reacts with dihydric alcohols to give polyesters using addition polymerisation reaction
Last Answer : D) Dibasic acids reacts with dihydric alcohols to give polyesters using addition polymerisation reaction
Description : Side chains of all following amino acids contain aromatic rings except (A) Phenyl alanine (B) Alanine (C) Tyrosine (D) Tryptophan
Description : Side chains of all amino acids contain aromatic rings except (A) Pheynl alanine (B) Alanine (C) Tyrosine (D) Tryptophan
Description : Aromatic amino acids can be detected by (A) Sakaguchi reaction (B) Millon-Nasse reaction (C) Hopkins-Cole reaction (D) Xanthoproteic reaction
Description : The enzyme trypsin is specific for peptide bonds of (A) Basic amino acids (B) Acidic amino acids (C) Aromatic amino acids (D) Next to small amino acid residues
Description : Give the names of aromatic amino acids.
Last Answer : Phenylalanine and tyrosine.
Description : Which of the following statement(s) is/are true concerning the treatment of MOFS? a. Prevention and therapy of MOFS requires control of the infectious or inflammatory source b. Restoration of normal ... of the nature of gut injury, total parenteral nutrition is preferred for most patients with MOFS
Last Answer : Answer: a, c The therapy of MOFS is directed towards interrupting the involving pathophysiologic process and providing an optimal physiologic environment for healing and recovery. ... Enteral absorption and processing of nutrients appears superior to TPN and lessens overall complications
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Maple syrup urine disease?
Last Answer : DefinitionMaple syrup urine disease (MSUD) is a metabolism disorder passed down through families in which the body cannot break down certain parts of proteins. Urine in persons with this condition ... . Even in the mildest form, repeated periods of physical stress can cause mental retardationand h
Description : -child , urine odor like burned sugar: - Phenylketonuria - Maple syrup urine disease
Last Answer : Maple syrup urine disease _______________________________
Description : Inborn errors of metabolism?
Last Answer : DefinitionInborn errors of metabolism are rare genetic disorders in which the body cannot properly turn food into energy. The disorders are usually caused by defects in specific ... of inborn errors of metabolism:Fructose intoleranceGalactosemiaMaple sugar urine disease (MSUD)Phenylketonuria(P
Description : In thalassemia, an amino acid is substituted in (A) Alpha chain (B) Beta chain (C) Alpha and beta chains (D) Any chain MINERAL METABOLISM 195
Description : Degradation of proteins to amino acids, glucose from carbohydrates and fatty acids from lipids is known as (A) Anabolism (B) Metabolism (C) Catabolism (D) Cretinism
Description : In human and other ureotelic organisms, the end product of amino acid nitrogen metabolism: (A) Bile acids (B) Ketone bodies (C) Urea (D) Barium sulphate
Description : Non essential amino acids (A) Are not components of tissue proteins (B) May be synthesized in the body from essential amino acids (C) Have no role in the metabolism (D) May be synthesized in the body in diseased states
Last Answer : (B) May be synthesized in the body from essential amino acids
Description : Which of the following enzyme defects is associated with a characteristic body odour? 1) Phenylalanine aminotransferase 2) Galactose0-phosphate-uridyltransferase 3) Ornithine transcarbamylase deficiency 4) Fumaryl acetoacetase 5) Branched chain ketoacid decarboxylase
Last Answer : Answers-5 The following inborn errors of amino acid metabolism are associated with abnormal odours: Glutaric acidaemia type II (sweaty feet), hawkinsinuria (swimming pool), isovaleric acidaemia (sweaty feet), ... The general rule is that if a child smells peculiar he requires a metabolic work-up.
Description : Chemically, lipoic acid is (A) Saturated fatty acid (B) Unsaturated fatty acid (C) Amino acid (D) Sulphur containing fatty acid
Description : Ethereal sulphate is synthesized from the _________ amino acid. (A) Neutral (B) Acidic (C) Basic (D) Sulphur containing
Description : The sulphur containing amino acid: (A) Homoserine (B) Serine (C) Methionine (D) Valine
Description : Sulphur-containing amino acid is (A) Glutathione (B) Chondroitin sulphate (C) Homocysteine (D) Tryptophan
Description : An example of sulphur containing amino acid is (A) 2-Amino-3-mercaptopropanoic acid (B) 2-Amino-3-methylbutanoic acid (C) 2-Amino-3-hydroxypropanoic acid (D) Amino acetic acid
Description : Sulphur containing amino acid is (A) Methionine (B) Leucine (C) Valine (D) Asparagine
Last Answer : (A) 2-Amino-3-mercaptopropanoic acid
Last Answer : (A) Methionine
Description : When carboxylic acids and dicarboxylic acids have similar molecular weights, how do their melting points compare? (a) Carboxylic acids have greater melting points. (b) Dicarboxylic acids have greater melting points. (c) Both acids have similar melting points. (d) No consistent trend exists
Last Answer : Dicarboxylic acids have greater melting points
Description : Carboxylic acid reacts with halogen in presence of red P to gives__________ a) α-halogen acids b) β-halogen acid c) Acid halide d) Dicarboxylic acid
Last Answer : a) α-halogen acids