Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine
Last Answer : Answer : D
Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids
Last Answer : Answer : C
Description : All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine
Last Answer : Answer : B
Description : A modified amino acid solution with increased equimolar branched-chain amino acids and decreased aromatic amino acids has been proposed for patients with hepatic insufficiency. Which of the following ... D. In some studies of surgical patients, improvements in mortality have been reported.
Last Answer : Answer: D DISCUSSION: The use of modified amino acid solutions is based on the false neurotransmitter hypothesis of the cause of hepatic coma. According to this hypothesis, the imbalance ... in a group of patients with cirrhosis, decreasing morbidity and showing a trend toward decreased mortality
Description : Maple syrup urine disease results from absence or serve deficiency of (A) Homogentisate oxidase (B) Phenylalanine hydroxylase (C) Branched chain amino acid transaminase (D) None of these
Description : Pick out the wrong statement. (A) Linear polymers are formed from bifunctional groups only and are normally thermoplastic (B) Cross-linked branched chain polymers are either elastometric or ... (D) Dibasic acids reacts with dihydric alcohols to give polyesters using addition polymerisation reaction
Last Answer : D) Dibasic acids reacts with dihydric alcohols to give polyesters using addition polymerisation reaction
Description : Which of the following enzyme defects is associated with a characteristic body odour? 1) Phenylalanine aminotransferase 2) Galactose0-phosphate-uridyltransferase 3) Ornithine transcarbamylase deficiency 4) Fumaryl acetoacetase 5) Branched chain ketoacid decarboxylase
Last Answer : Answers-5 The following inborn errors of amino acid metabolism are associated with abnormal odours: Glutaric acidaemia type II (sweaty feet), hawkinsinuria (swimming pool), isovaleric acidaemia (sweaty feet), ... The general rule is that if a child smells peculiar he requires a metabolic work-up.
Description : All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons
Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin
Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
Description : Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38
Description : The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain
Description : Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain
Description : The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Branched chain polymers compared to linear polymers have higher (A) Density (B) Tensile strength (C) Melting point (D) Degree of irregularity in atomic packing
Last Answer : (D) Degree of irregularity in atomic packing
Description : . In a linear polymer, the monomeric units are linked together to form long straight chains. The cross linked or branched chain polymers compared to linear polymers have higher (A) Densities (B) Melting point (C) Tensile strength (D) Hardness, rigidity & brittleness
Last Answer : (D) Hardness, rigidity & brittleness
Description : Choose the correct statement. (A) Octane number of i-octane is zero (B) Octane number of paraffins increases with increasing number of carbon atoms (C) Branched chain paraffins have higher octane ... atoms (D) The aromatics have lower octane number than naphthenes with same number of carbon atoms
Last Answer : (A) Octane number of i-octane is zero
Description : Cellulose, the most important constituent of plant cell wall is made up of (a) branched chain of glucose molecules linked by β-1, 4 glycosidic bond in straight chain and α-1, 6 glycosidic bond ... the site of branching (d) unbranched chain of glucose molecules linked by α-1, 4 glycosidic bond.
Last Answer : (b) unbranched chain of glucose molecules linked by β-1, 4 glycosidic bond
Description : Which of the following statements best describes the difference between amylose and amylopectin? (a) Amylose is a branched polysaccharide while amylopectin is a chain polysaccharide. (b) Amylose is a ... of thousands of D-glucose units while amylopectin is composed of thousands of D-galactose units.
Last Answer : Amylose is a straight-chain polysaccharide while amylopectin is a branched polysaccharide
Description : Which of the following methods can be used to increase the octane rating of gasoline? (a) Adding branched-chain alkanes (b) Adding tetraethyllead (c) Adding aromatic hydrocarbons (d) All of these
Last Answer : All of these
Description : The phospholipids present in cytoplasm membrane of the archaeo- bacteria is A- phosphoglycerides B- polyisoprenoid C- polyisoprenoid branched chain lipids D- none of the bove
Last Answer : polyisoprenoid branched chain lipids
Description : The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?
Last Answer : beads of different colors joined together on a piece of string
Description : What type of molecule is made from a long chain of amino acids?
Last Answer : protein
Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
Last Answer : Ans. ((b))
Description : Which of the following statement(s) is/are true concerning the treatment of MOFS? a. Prevention and therapy of MOFS requires control of the infectious or inflammatory source b. Restoration of normal ... of the nature of gut injury, total parenteral nutrition is preferred for most patients with MOFS
Last Answer : Answer: a, c The therapy of MOFS is directed towards interrupting the involving pathophysiologic process and providing an optimal physiologic environment for healing and recovery. ... Enteral absorption and processing of nutrients appears superior to TPN and lessens overall complications
Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours
Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis
Description : Which of the following is the quaternary structure of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with ... (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone
Last Answer : description of the way the peptide chains are arranged with respect to each other
Description : Site in the ribosome from which the tRNA donates amino acids to the growing polypeptide chain is A- P site B- O site C- T site D- A site
Last Answer : P site
Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four
Last Answer : Three
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : A polymeric unit of starch which has a branched structure is (A) Glucose (B) Amylopectin (C) Isomaltose (D) Amylose
Description : In E. coli the chain initiating amino acid in protein synthesis is (A) N-formyl methionine(B) Methionine (C) Serine (D) Cysteine
Last Answer : Answer : A
Description : Erythromycin binds to 50 S ribosomal sub unit and (A) Inhibits binding of amino acyl tRNA (B) Inhibits Peptidyl transferase activity (C) Inhibits translocation (D) Causes premature chain termination
Description : In the process of elongation of chain binding of amino acyl tRNA to the A site requires (A) A proper codon recognition (B) GTP (C) EF-II (D) GDP
Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine
Description : In the B chain of insulin molecule, the C-terminal amino acid: (A) Threonine (B) Tyrosine (C) Glutamate (D) Valine
Description : In the B chain of insulin molecule, the Nterminal amino acid is (A) Proline (B) Threonine (C) Phenylalanine (D) Lysine
Description : In the A chain of insulin molecule the Cterminal amino acid is (A) Asparagine (B) Threonine (C) Valine (D) Tyrosine
Description : In A chain of the insulin molecule the Nterminal amino acid is (A) Glycine (B) Valine (C) Serine (D) Phenylalanine
Description : In thalassemia, an amino acid is substituted in (A) Alpha chain (B) Beta chain (C) Alpha and beta chains (D) Any chain MINERAL METABOLISM 195
Description : Which amino acid is present at 6th position of β-chain of Hbs instead of glutamate in HbA? (A) Cysteine (B) Valine (C) Aspartate (D) Glutamate
Description : The side chain of which of the following amino acid contain sulphur atom? (A) Methionine (B) Threonine (C) Leucine (D) Tryptophan
Description : The pH of an amino acid depends (A) Optical rotation (B) Dissociation constant (C) Diffusion coefficient(D) Chain length
Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
Description : An amino acid having a hydrophilic side chain is (A) Alanine (B) Proline (C) Methionine (D) Serine
Description : The amino acid with a nonpolar side chain is (A) Serine (B) Valine (C) Asparagine (D) Threonine
Description : Amino acid with side chain containing basic groups is (A) 2-Amino 5-guanidovaleric acid (B) 2-Pyrrolidine carboxylic acid (C) 2-Amino 3-mercaptopropanoic acid (D) 2-Amino propanoic acid
Last Answer : (A) 2-Amino 5-guanidovaleric acid
Description : Calcium absorption is inferred by (A) Fatty acids (B) Amino acids (C) Vitamin D (D) Vitamin B12