A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

A prokaryotic mRNA that consists of 999 nucleotides will code for
how many amino acids?
a. 332
b. 333
c. 666
d. 999
by

1 Answer

Answer :

a. 332
by

Related questions

If there are 999 bases in an RNA that code for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered? (a) 11 (b) 33 (c) 333 (d) 1

Description : If there are 999 bases in an RNA that code for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered? (a) 11 (b) 33 (c) 333 (d) 1

Last Answer : (d) 1

If there are 999 bases in an RNA that code for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered? (a) 11 (b) 33 (c) 333 (d) 1

Description : If there are 999 bases in an RNA that code for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered? (a) 11 (b) 33 (c) 333 (d) 1

Last Answer : b) 33

If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ? (1) 11 (2) 33 (3) 333 (4) 1

Description : If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered ? (1) 11 (2) 33 (3) 333 (4) 1

Last Answer : (2) 33

Which one of the following pairs is mismatched? a. Protein - amino acids b. Nucleic acid - nucleotides c. Fats - glycogen d. Starch - glucose

Description : Which one of the following pairs is mismatched? a. Protein - amino acids b. Nucleic acid - nucleotides c. Fats - glycogen d. Starch - glucose

Last Answer : c. Fats - glycogen

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

In which Article of the Constitution of India was the provision for reservation of scheduled castes in the Lok Sabha made? (1) Article 330 (2) Article 331 (3) Article 332 (4) Article 333

Description : In which Article of the Constitution of India was the provision for reservation of scheduled castes in the Lok Sabha made? (1) Article 330 (2) Article 331 (3) Article 332 (4) Article 333

Last Answer : (1) Article 330 Explanation: In the Indian Constitution, seats have been reserved in the Lok Sabha for Scheduled Castes and Scheduled Tribes in Article -330.

What is the latent heat of fusion of water at 1 atm?  A. 331.1 kJ/kg  B. 332.6 kJ/kg  C. 333.7 kJ/kg  D. 330.7 kJ/kg

Description : What is the latent heat of fusion of water at 1 atm?  A. 331.1 kJ/kg  B. 332.6 kJ/kg  C. 333.7 kJ/kg  D. 330.7 kJ/kg

Last Answer : 333.7 kJ/kg

If profit of the company is Rs 20,000 , sales is 10 per unit and variable cost is Rs 4 per unit calculate Margin of safety. a) Rs 33,333.33 b) Rs 16,666.67 c) Rs 10,000 d) Rs 20,000

Description : If profit of the company is Rs 20,000 , sales is 10 per unit and variable cost is Rs 4 per unit calculate Margin of safety. a) Rs 33,333.33 b) Rs 16,666.67 c) Rs 10,000 d) Rs 20,000

Last Answer : a) Rs 33,333.33

Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Description : Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Last Answer : formylmethionine

Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Description : Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Last Answer : formylmethionine

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

How many amino acids are coded for by this sequence of nucleotides?

Description : How many amino acids are coded for by this sequence of nucleotides?

Last Answer : Need answer

What sequence of amino acids will correspond to this set of nucleotides AUGCCUACGUGGAC?

Description : What sequence of amino acids will correspond to this set of nucleotides AUGCCUACGUGGAC?

Last Answer : What is the answer ?

Selectins are proteins that can recognise specific (A) Carbohydrates (B) Lipids (C) Amino acids (D) Nucleotides

Description : Selectins are proteins that can recognise specific (A) Carbohydrates (B) Lipids (C) Amino acids (D) Nucleotides

Last Answer : Answer : A

Which of the following choices are considered to be polymers of amino acids? Are they: w) nucleotides x) carbohydrates y) lipids z) proteins

Description : Which of the following choices are considered to be polymers of amino acids? Are they: w) nucleotides x) carbohydrates y) lipids z) proteins

Last Answer : ANSWER: Z -- PROTEINS 

Which of the following is true about cell wall of gram-positive bacteria? A- It consists of multiple layers B- It is thicker than that associated with gram-negative bacteria C- It contains teichoic acids D- D.All of these

Description : Which of the following is true about cell wall of gram-positive bacteria? A- It consists of multiple layers B- It is thicker than that associated with gram-negative bacteria C- It contains teichoic acids D- D.All of these

Last Answer : D.All of these

Which of the following is true about cell wall of gram-positive bacteria? A-It consists of multiple layers B- It is thicker than that associated with gram-negative bacteria C- It contains teichoic acids D- All of these

Description : Which of the following is true about cell wall of gram-positive bacteria? A-It consists of multiple layers B- It is thicker than that associated with gram-negative bacteria C- It contains teichoic acids D- All of these

Last Answer : All of these

A vehicle suspension system consists of a spring and a damper. Stiffness of spring is 3.5 KN/m and damping constant of damper is 400Ns/m. If mass is 50 kg, then damping factor is A 0.606 B 0.10 C 0.666 D 0.471

Description : A vehicle suspension system consists of a spring and a damper. Stiffness of spring is 3.5 KN/m and damping constant of damper is 400Ns/m. If mass is 50 kg, then damping factor is A 0.606 B 0.10 C 0.666 D 0.471

Last Answer : D 0.471

A vehicle suspension system consists of a spring and a damper. The stiffness of the spring is 3.6 kN/m and the damping constant of the damper is 400 Ns/m. If the mass is 50 kg, then the damping factor (d ) and damped natural frequency (f n ), respectively, are a) 0.471 and 1.19 Hz b) 0.471 and 7.48 Hz c) 0.666 and 1.35 Hz

Description : A vehicle suspension system consists of a spring and a damper. The stiffness of the spring is 3.6 kN/m and the damping constant of the damper is 400 Ns/m. If the mass is 50 kg, then the damping factor (d ) and damped natural ... , are a) 0.471 and 1.19 Hz b) 0.471 and 7.48 Hz c) 0.666 and 1.35 Hz

Last Answer : a) 0.471 and 1.19 Hz

A vehicle suspension system consists of a spring and a damper. The stiffness of the spring is 3.6 kN/m and the damping constant of the damper is 400 Ns/m. If the mass is 50 kg, then the damping factor (d ) and damped natural frequency (f n ), respectively, are a) 0.471 and 1.19 Hz b) 0.471 and 7.48 Hz c) 0.666 and 1.35 Hz d) 0.666 and 8.50 Hz

Description : A vehicle suspension system consists of a spring and a damper. The stiffness of the spring is 3.6 kN/m and the damping constant of the damper is 400 Ns/m. If the mass is 50 kg, then the damping factor (d ) and damped natural ... .19 Hz b) 0.471 and 7.48 Hz c) 0.666 and 1.35 Hz d) 0.666 and 8.50 Hz

Last Answer : a) 0.471 and 1.19 Hz

Viroids and prions differ in that viroids are believed to contain only ______, while prions are believed to contain only _______. a. carbohydrate; amino acids b. nucleic acid; protein c. amino acids; carbohydrate d. protein; nucleic acid

Description : Viroids and prions differ in that viroids are believed to contain only ______, while prions are believed to contain only _______. a. carbohydrate; amino acids b. nucleic acid; protein c. amino acids; carbohydrate d. protein; nucleic acid

Last Answer : b. nucleic acid; protein

A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, rather than L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine

Description : A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, ... L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine

Last Answer : C.proteins are synthesized from

Commercial scale production of amino acids is typically carried out using A- regulatory mutants to cause overproduction of biochemical intermediates B- creation of an intentional increase in membrane permeability to increase release of the amino acids C- both (a) and (b) D- none of the above

Description : Commercial scale production of amino acids is typically carried out using A- regulatory mutants to cause overproduction of biochemical intermediates B- creation of an intentional increase in membrane permeability to increase release of the amino acids C- both (a) and (b) D- none of the above

Last Answer : both (a) and (b)

Site in the ribosome from which the tRNA donates amino acids to the growingpolypeptide chain is A- P site B- O site C- T site D- A site

Description : Site in the ribosome from which the tRNA donates amino acids to the growing polypeptide chain is A- P site B- O site C- T site D- A site

Last Answer : P site

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

The last step in synthesis of peptidoglycan is A- attachment of a peptide to muramic acid B- attaching two amino acids to form a cross-link C- attachment of a portion of peptidoglycan to a membrane lipid D- binding of penicillin to a membrane protein

Description : The last step in synthesis of peptidoglycan is A- attachment of a peptide to muramic acid B- attaching two amino acids to form a cross-link C- attachment of a portion of peptidoglycan to a membrane lipid D- binding of penicillin to a membrane protein

Last Answer : attaching two amino acids to form a cross-link

Archeal cells usually do not contain peptidoglycan, rather contain pseudo- peptidoglycanwhichis mainly composed of A-.N-acetylmuramic acid and L-amino acids B-.N-acetylmuramic acid and D-amino acids C-.N-acetyltalosaminuronic acid and D-amino acids D-N-acetyltalosaminuronic acid and L-amino acids

Description : Archeal cells usually do not contain peptidoglycan, rather contain pseudo- peptidoglycanwhichis mainly composed of A-.N-acetylmuramic acid and L-amino acids B-.N-acetylmuramic acid and D-amino acids C-.N-acetyltalosaminuronic acid and D-amino acids D-N-acetyltalosaminuronic acid and L-amino acids

Last Answer : N-acetyltalosaminuronic acid and L-amino acids

A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine

Description : A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine

Last Answer : .proteins are synthesized from D-, rather than L-, isomers of amino acids

What are the building blocks of proteins? a. monosaccharaides b. amino acids c. fatty acids d. glycerol

Description : What are the building blocks of proteins? a. monosaccharaides b. amino acids c. fatty acids d. glycerol

Last Answer : b. amino acids

Proteins are chains of _____ that sometimes function as _____. a. monosaccharaides; energy compounds b. lipids; structural materials c. amino acids; enzymes d. disaccharides; enzymes

Description : Proteins are chains of _____ that sometimes function as _____. a. monosaccharaides; energy compounds b. lipids; structural materials c. amino acids; enzymes d. disaccharides; enzymes

Last Answer : c. amino acids; enzymes

The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Description : The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Last Answer : a. primary

Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Last Answer : Answer : C

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Description : The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Last Answer : Ans:(d)

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Which one of the following statements is not true of RNA? a. RNA contains the monosaccharide ribose. b. RNA is primarily a single-stranded molecule. c. RNA has a sugar-phosphate backbone. d. RNA contains five different nucleotides.

Description : Which one of the following statements is not true of RNA? a. RNA contains the monosaccharide ribose. b. RNA is primarily a single-stranded molecule. c. RNA has a sugar-phosphate backbone. d. RNA contains five different nucleotides.

Last Answer : d. RNA contains five different nucleotides.

Stem and loop structures are A- proteins that help partially denatured enzymes to recover their native configuration B- structures in DNA caused by inverted repeats C- structures at the ends of linear eukaryotic DNA molecules D- the bonds between adjacent DNA nucleotides in the same strand

Description : Stem and loop structures are A- proteins that help partially denatured enzymes to recover their native configuration B- structures in DNA caused by inverted repeats C- structures at the ends of linear eukaryotic DNA molecules D- the bonds between adjacent DNA nucleotides in the same strand

Last Answer : structures in DNA caused by inverted repeats

What is the term used for a segment of DNA with one or more genes in the centre and the twoends carrying inverte d repeat sequences of nucleotides? A- Plasmid B- Transposon C- Insertion sequence D- None of these

Description : What is the term used for a segment of DNA with one or more genes in the centre and the twoends carrying inverte d repeat sequences of nucleotides? A- Plasmid B- Transposon C- Insertion sequence D- None of these

Last Answer : Transposon

All the following characteristics apply to fungi except: a. There may be 1.5 million species. b. They lack chlorophyll. c. They include molds and yeasts. d. They are prokaryotic microorganisms.

Description : All the following characteristics apply to fungi except: a. There may be 1.5 million species. b. They lack chlorophyll. c. They include molds and yeasts. d. They are prokaryotic microorganisms.

Last Answer : d. They are prokaryotic microorganisms.

Which one of the following is common between prokaryotic and eukaryotic chromosomes? a. Presence or absence of introns. b. Loop or linear chromosomes. c. Genetic recombination occurrence in RNA. d. Mutations occur in the DNA.

Description : Which one of the following is common between prokaryotic and eukaryotic chromosomes? a. Presence or absence of introns. b. Loop or linear chromosomes. c. Genetic recombination occurrence in RNA. d. Mutations occur in the DNA.

Last Answer : d. Mutations occur in the DNA.

What is a difference between prokaryotic and eukaryotic cells in making protein? a. Eukayotes have introns that stay inside the nucleus b. Prokaryotes can transcribe and translate at the same time c. the process is faster in prokaryotes d. A-C are correct

Description : What is a difference between prokaryotic and eukaryotic cells in making protein? a. Eukayotes have introns that stay inside the nucleus b. Prokaryotes can transcribe and translate at the same time c. the process is faster in prokaryotes d. A-C are correct

Last Answer : d. A-C are correct

Where is ATP produced in prokaryotic cells? a. In The Mitochondria b. In The Chloroplast c. On The Cell Membrane d. On The Ribosomes

Description : Where is ATP produced in prokaryotic cells? a. In The Mitochondria b. In The Chloroplast c. On The Cell Membrane d. On The Ribosomes

Last Answer : b. In The Chloroplast

Which of the following is not true for prokaryotic organism? A.Nucleus is not bounded by nuclear membrane B.Chromosomes does not contain histones C.80S ribosomes are distributed in cytoplasm D.Cell wall contains peptidoglycan as one of the major component

Description : Which of the following is not true for prokaryotic organism? A.Nucleus is not bounded by nuclear membrane B.Chromosomes does not contain histones C.80S ribosomes are distributed in cytoplasm D.Cell wall contains peptidoglycan as one of the major component

Last Answer : C.80S ribosomes are distributed in cytoplasm

Which of the following is not true for prokaryotic organism? A- Nucleus is not bounded by nuclear membrane B- Chromosomes does not contain histones C- 80S ribosomes are distributed in cytoplasm D- Cell wall contains peptidoglycan as one of the major component

Description : Which of the following is not true for prokaryotic organism? A- Nucleus is not bounded by nuclear membrane B- Chromosomes does not contain histones C- 80S ribosomes are distributed in cytoplasm D- Cell wall contains peptidoglycan as one of the major component

Last Answer : 80S ribosomes are distributed in cytoplasm

------------ is mainly present in prokaryotic cells A Mitochondria B ER C Golgi apparatus D Mesosomes

Description : ------------ is mainly present in prokaryotic cells A Mitochondria B ER C Golgi apparatus D Mesosomes

Last Answer : D Mesosomes

--------- prokaryotic microorganism A Fungi B Rickettsiae C Algae D Protozoa

Description : --------- prokaryotic microorganism A Fungi B Rickettsiae C Algae D Protozoa

Last Answer : B Rickettsiae

In contrast to Eukaryotic mRNA, prokaryotic mRNA is characterized by (A) Having 7-methyl guanosine triphosphate at the 5’ end (B) Being polycystronic (C) Being only monocystronic (D) Being synthesized with introns

Description : In contrast to Eukaryotic mRNA, prokaryotic mRNA is characterized by (A) Having 7-methyl guanosine triphosphate at the 5’ end (B) Being polycystronic (C) Being only monocystronic (D) Being synthesized with introns

Last Answer : Answer : A