Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
Last Answer : Answer : B
Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin
Last Answer : Answer : C
Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
Last Answer : Ans. ((b))
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Site in the ribosome from which the tRNA donates amino acids to the growing polypeptide chain is A- P site B- O site C- T site D- A site
Last Answer : P site
Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis
Last Answer : adaptor hypothesis
Description : 5. Some amino acids are coded by more than one codon hence the codon is said to be a)Universal b)Degenerate c)Unambiguous d)Specific
Last Answer : b)Degenerate
Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine
Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix
Last Answer : the amino acid sequence in the polypeptide chain
Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.
Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.
Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.
Last Answer : (a) A polypeptide of 24 amino acids will be formed.
Description : How many amino acids are coded for by this sequence of nucleotides?
Last Answer : Need answer
Description : .In the genetic dictionary, there are 64 codons as (a) 64 amino acids are to be coded (b) 64 types of tRNAs are present (c) there are 44 nonsense codons and 20 sense codons (d) genetic code is triplet.
Last Answer : (c) there are 44 nonsense codons and 20 sense codons
Description : In the genetic dictionary, there are 64 codons as (a) 64 amino acids are to be coded (b) 64 types of tRNAs are present (c) there are 44 nonsense codons and 20 sense codons (d) genetic code is triplet
Last Answer : genetic code is triplet
Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.
Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150
Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids
Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Last Answer : Answer : A
Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction
Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide
Last Answer : b) Nucleic acids in a nucleotide
Description : The last step in synthesis of peptidoglycan is A- attachment of a peptide to muramic acid B- attaching two amino acids to form a cross-link C- attachment of a portion of peptidoglycan to a membrane lipid D- binding of penicillin to a membrane protein
Last Answer : attaching two amino acids to form a cross-link
Description : Viroids and prions differ in that viroids are believed to contain only ______, while prions are believed to contain only _______. a. carbohydrate; amino acids b. nucleic acid; protein c. amino acids; carbohydrate d. protein; nucleic acid
Last Answer : b. nucleic acid; protein
Description : A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999
Last Answer : a. 332
Description : A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, ... L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine
Last Answer : C.proteins are synthesized from
Description : Commercial scale production of amino acids is typically carried out using A- regulatory mutants to cause overproduction of biochemical intermediates B- creation of an intentional increase in membrane permeability to increase release of the amino acids C- both (a) and (b) D- none of the above
Last Answer : both (a) and (b)
Description : Archeal cells usually do not contain peptidoglycan, rather contain pseudo- peptidoglycanwhichis mainly composed of A-.N-acetylmuramic acid and L-amino acids B-.N-acetylmuramic acid and D-amino acids C-.N-acetyltalosaminuronic acid and D-amino acids D-N-acetyltalosaminuronic acid and L-amino acids
Last Answer : N-acetyltalosaminuronic acid and L-amino acids
Description : A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine
Last Answer : .proteins are synthesized from D-, rather than L-, isomers of amino acids
Description : What are the building blocks of proteins? a. monosaccharaides b. amino acids c. fatty acids d. glycerol
Last Answer : b. amino acids
Description : Proteins are chains of _____ that sometimes function as _____. a. monosaccharaides; energy compounds b. lipids; structural materials c. amino acids; enzymes d. disaccharides; enzymes
Last Answer : c. amino acids; enzymes
Description : Which one of the following pairs is mismatched? a. Protein - amino acids b. Nucleic acid - nucleotides c. Fats - glycogen d. Starch - glucose
Last Answer : c. Fats - glycogen
Description : The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary
Last Answer : a. primary
Description : Two cyclic polypeptide antibiotics are a. Vancomycin and streptomycin. b. Penicillin and cephalosporin. c. Bacitracin and polymyxins d. .gentamicin and chloramphenicol
Last Answer : c. Bacitracin and polymyxins
Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape
Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape
Last Answer : aid a newly synthesized polypeptide in folding to its proper shape
Description : Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38
Description : If a serum is given to prevent a disease it is called a ______. a. therapeutic b. prophylactic c. synthetic d. convalescent
Last Answer : b. prophylactic
Description : If the carbon source in a growth medium is beef extract, the medium must be an example of a/an medium. a. complex b. chemically defined c. enriched d. synthetic
Last Answer : a. complex
Description : The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?
Last Answer : beads of different colors joined together on a piece of string
Description : What type of molecule is made from a long chain of amino acids?
Last Answer : protein
Description : All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons
Description : The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain
Description : Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain
Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine
Last Answer : Answer : D
Description : The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids
Description : All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine
Description : Which of the following statement(s) is/are true concerning the treatment of MOFS? a. Prevention and therapy of MOFS requires control of the infectious or inflammatory source b. Restoration of normal ... of the nature of gut injury, total parenteral nutrition is preferred for most patients with MOFS
Last Answer : Answer: a, c The therapy of MOFS is directed towards interrupting the involving pathophysiologic process and providing an optimal physiologic environment for healing and recovery. ... Enteral absorption and processing of nutrients appears superior to TPN and lessens overall complications