The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes
by

1 Answer

Answer :

Ans:(d)  
by
selected

Related questions

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Last Answer : Answer : C

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape

An important step in protein synthesis is transcription. Which of the following statement(s) is/are true concerning this process? a. The first step in gene transcription involves separating the double helix of DNA by an enzyme known as DNA polymerase b. The initial product of DNA transcription is called heterogeneous nuclear RNA which codes directly for proteins c. After processing is complete, the mRNA is exported from the nucleus to the cytoplasm d. Only one protein can be produced from an initial mRNA strand

Description : An important step in protein synthesis is transcription. Which of the following statement(s) is/are true concerning this process? a. The first step in gene transcription involves separating the double helix ... nucleus to the cytoplasm d. Only one protein can be produced from an initial mRNA strand

Last Answer : Answer: c Transcription of a gene begins at an initiation site associated with a specific DNA sequence, termed a promoter region. After binding to DNA, the RNA polymerase opens up a short ... different proteins from the same gene. mRNA is exported from the nucleus only after processing is complete

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Last Answer : a) rRNA

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Last Answer : tRNA

The newly entering amino acyl tRNA into A site requires (A) EF-II (B) Ribosomal RNA (C) mRNA (D) EF-I

Description : The newly entering amino acyl tRNA into A site requires (A) EF-II (B) Ribosomal RNA (C) mRNA (D) EF-I

Last Answer : Answer : D

Which of the following is not true for prokaryotic organism? A.Nucleus is not bounded by nuclear membrane B.Chromosomes does not contain histones C.80S ribosomes are distributed in cytoplasm D.Cell wall contains peptidoglycan as one of the major component

Description : Which of the following is not true for prokaryotic organism? A.Nucleus is not bounded by nuclear membrane B.Chromosomes does not contain histones C.80S ribosomes are distributed in cytoplasm D.Cell wall contains peptidoglycan as one of the major component

Last Answer : C.80S ribosomes are distributed in cytoplasm

Which of the following is not true for prokaryotic organism? A- Nucleus is not bounded by nuclear membrane B- Chromosomes does not contain histones C- 80S ribosomes are distributed in cytoplasm D- Cell wall contains peptidoglycan as one of the major component

Description : Which of the following is not true for prokaryotic organism? A- Nucleus is not bounded by nuclear membrane B- Chromosomes does not contain histones C- 80S ribosomes are distributed in cytoplasm D- Cell wall contains peptidoglycan as one of the major component

Last Answer : 80S ribosomes are distributed in cytoplasm

RNA that transfer amino acids from cytoplasm to ribosome

Description : RNA that transfer amino acids from cytoplasm to ribosome

Last Answer : Ans. m-RNA

Protein synthesis in an animal cell occurs (a) only on the ribosomes present in cytosol (b) only on ribosome attached to the nuclear envelope and endoplasmic reticulum (c) on ribosome present in the nucleolus as well as in cytoplasm (d) on ribosomes present in cytoplasm as well as in mitochondria.

Description : Protein synthesis in an animal cell occurs (a) only on the ribosomes present in cytosol (b) only on ribosome attached to the nuclear envelope and endoplasmic reticulum (c) on ribosome present in the ... as well as in cytoplasm (d) on ribosomes present in cytoplasm as well as in mitochondria.

Last Answer : (d) on ribosomes present in cytoplasm as well as in mitochondria.

.Protein synthesis in an animal cell occurs (a) only on the ribosomes present in cytosol (b) only on ribosome attached to the nuclear envelope and endoplasmic reticulum (c) on ribosome present in the nucleolus as well as in cytoplasm (d) on ribosomes present in cytoplasm as well as in mitochondria.

Description : .Protein synthesis in an animal cell occurs (a) only on the ribosomes present in cytosol (b) only on ribosome attached to the nuclear envelope and endoplasmic reticulum (c) on ribosome present in the ... as well as in cytoplasm (d) on ribosomes present in cytoplasm as well as in mitochondria.

Last Answer : (d) on ribosomes present in cytoplasm as well as in mitochondria.

Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the cytoplasm. C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.

Description : Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the ... activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.

Last Answer : C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes.

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

The part of the cell which binds to the mRNA during protein systhesis is C A. Golgi bodies B. Lysosomes C. Ribosomes D. Food vacuoles

Description : The part of the cell which binds to the mRNA during protein systhesis is C A. Golgi bodies B. Lysosomes C. Ribosomes D. Food vacuoles

Last Answer : Ribosome

Chain elongation of fatty acids occurring in mammalian liver takes place in which of the following subcellular fractions of the cell? (A) Nucleus (B) Ribosomes (C) Lysosomes (D) Microsomes

Description : Chain elongation of fatty acids occurring in mammalian liver takes place in which of the following subcellular fractions of the cell? (A) Nucleus (B) Ribosomes (C) Lysosomes (D) Microsomes

Last Answer : Answer : D

There are two properties of the cell necessary to maintain nonequilibrium cellular composition; the first is selectivity and the second is energy conversion. Which of the following statement(s) is/are true concerning energy converting transport? a. The site of energy conversion and transport in the plasma membrane involves the phospholipid component b. The Na+-K++-ATPase derives energy from hydrolysis of extracellular ATP c. In some systems, energy inherent in the transmembrane ion gradient can be used to drive transport of a second species d. Examples of species transported via secondary active transport include hydrogen ions, calcium, amino acids and glucose

Description : There are two properties of the cell necessary to maintain nonequilibrium cellular composition; the first is selectivity and the second is energy conversion. Which of the following statement(s ... transported via secondary active transport include hydrogen ions, calcium, amino acids and glucose

Last Answer : Answer: c, d The selectivity of the plasma membrane, although impressive, cannot account for the nonequilibrium composition of living cells. A cell can be maintained in a nonequilibrium state only by ... to drive the transport of a second species such as protons, calcium, amino acids, or glucose

All the following statements about carnitine are true except (A) It can be synthesised in the human body (B) It can be synthesized from methionine and lysine (C) It is required for transport of short chain fatty acids into mitochondria (D) Its deficiency can occur due to haemodialysis

Description : All the following statements about carnitine are true except (A) It can be synthesised in the human body (B) It can be synthesized from methionine and lysine (C) It is required for transport of short chain fatty acids into mitochondria (D) Its deficiency can occur due to haemodialysis

Last Answer : Answer : C

All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland (C) It is the precursor of ACTH and melatonin (D) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Description : All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland ... ) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Which of the following amino acids was not found to be synthesised in Miller’s experiment? (a) Alanine (b) Glycine (c) Aspartic acid (d) Glutamic acid (

Description : Which of the following amino acids was not found to be synthesised in Miller’s experiment? (a) Alanine (b) Glycine (c) Aspartic acid (d) Glutamic acid (

Last Answer : (d) Glutamic acid

Amino acids are mostly synthesised from (a) mineral salts (b) fatty acids (c) volatile acids (d) α-ketoglutaric acid.

Description : Amino acids are mostly synthesised from (a) mineral salts (b) fatty acids (c) volatile acids (d) α-ketoglutaric acid.

Last Answer : (d) α-ketoglutaric acid.

Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Description : Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Last Answer : mRNA

Which amino acid is synthesised after it gets in- corporated into the protein?

Description : Which amino acid is synthesised after it gets in- corporated into the protein?

Last Answer : Hydroxyproline

Chain elongation of fatty acids in mammalian liver occurs in (A) Nucleus (B) Ribosomes (C) Lysosomes (D) Microsomes

Description : Chain elongation of fatty acids in mammalian liver occurs in (A) Nucleus (B) Ribosomes (C) Lysosomes (D) Microsomes

Last Answer : Answer : D

Nucleoproteins are synthesised in (a) nucleoplasm (b) nuclear envelope (c) nucleolus (d) cytoplasm.

Description : Nucleoproteins are synthesised in (a) nucleoplasm (b) nuclear envelope (c) nucleolus (d) cytoplasm.

Last Answer : (d) cytoplasm.

.Experiments on Acetabularia by Hammerling proved the role of (a) cytoplasm in controlling differentiation (b) nucleus in heredity (c) chromosomes in heredity (d) nucleo-cytoplasmic ratio.

Description : .Experiments on Acetabularia by Hammerling proved the role of (a) cytoplasm in controlling differentiation (b) nucleus in heredity (c) chromosomes in heredity (d) nucleo-cytoplasmic ratio.

Last Answer : (b) nucleus in heredity

Which of the following statements is correct? (A) a nucleo protein usually contain deoxy sugars of the hexose type (B) Nucleoproteins are usually absent from the cytoplasm (C) Nucleoproteins usually are present in the nucleus only (D) Nucleoproteins usually occur in the nucleus and cytoplasm

Description : Which of the following statements is correct? (A) a nucleo protein usually contain deoxy sugars of the hexose type (B) Nucleoproteins are usually absent from the cytoplasm (C) Nucleoproteins usually are present in the nucleus only (D) Nucleoproteins usually occur in the nucleus and cytoplasm

Last Answer : Answer : D

Ribosomal RNA is actively synthesised in (a) lysosomes (b) nucleolus (c) nucleoplasm (d) ribosomes.

Description : Ribosomal RNA is actively synthesised in (a) lysosomes (b) nucleolus (c) nucleoplasm (d) ribosomes.

Last Answer : (a) lysosomes

Ribosomal RNA is actively synthesised in (a) lysosomes (b) nucleolus (c) nucleoplasm (d) ribosomes.

Description : Ribosomal RNA is actively synthesised in (a) lysosomes (b) nucleolus (c) nucleoplasm (d) ribosomes.

Last Answer : (b) nucleolus

The proteins are synthesised at (a) centrosomes (b) Golgi bodies (c) ribosomes (d) mitochondria.

Description : The proteins are synthesised at (a) centrosomes (b) Golgi bodies (c) ribosomes (d) mitochondria.

Last Answer : (c) ribosomes

A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Description : A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Last Answer : a. 332

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

The function of Haemoglobin is to : (1) provide amino acids (2) carry oxygen (3) provide enzymes (4) help in excretion

Description : The function of Haemoglobin is to : (1) provide amino acids (2) carry oxygen (3) provide enzymes (4) help in excretion

Last Answer : (2) carry oxygen Explanation: Haemoglobin is an ironcontaining protein in red blood cells. Hemoglobin in the blood carries oxygen from the respiratory organs (lungs or gills) to the rest of ... resultant carbon dioxide to bring it back to the respiratory organs to be dispensed from the organism.

The function of Haemoglobin is to : (1) provide amino acids (2) carry oxygen (3) provide enzymes (4) help in excretion

Description : The function of Haemoglobin is to : (1) provide amino acids (2) carry oxygen (3) provide enzymes (4) help in excretion

Last Answer :  carry oxygen

In eukaryotes, mRNA is synthesised with the aid of

Description : In eukaryotes, mRNA is synthesised with the aid of

Last Answer : In eukaryotes, mRNA is synthesised with the aid of A. RNA polymerase 3 B. RNA polymerase 2 C. RNA polymerase 1 D. Reverse transcriptase

mRNA is synthesised on DNA template in which direction? (a) 5′ → 3′ (b) 3′ → 5′ (c) Both (a) and (b) (d) Any

Description : mRNA is synthesised on DNA template in which direction? (a) 5′ → 3′ (b) 3′ → 5′ (c) Both (a) and (b) (d) Any

Last Answer : a) 5′ → 3′

mRNA is synthesised on DNA template in which direction? (a) 5′ → 3′ (b) 3′ → 5′ (c) Both (a) and (b) (d) Any

Description : mRNA is synthesised on DNA template in which direction? (a) 5′ → 3′ (b) 3′ → 5′ (c) Both (a) and (b) (d) Any

Last Answer : (a) 5′ → 3′

The major site of protein breakdown to form free amino acids, is the

Description : The major site of protein breakdown to form free amino acids, is the

Last Answer : The major site of protein breakdown to form free amino acids, is the A. Kidney B. Spleen C. Liver D. Bone-marrow

Site of Protein synthesis in cell is — a. Mitochonderia b. Ribosomes c. Cell wall d. Chloroplast

Description : Site of Protein synthesis in cell is — a. Mitochonderia b. Ribosomes c. Cell wall d. Chloroplast

Last Answer : b. Ribosomes

Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Last Answer : Answer : A

Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (b) tRNA

.Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : .Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (c) mRNA

Who is the best YouTube video promotion company1.Videopromotion.club2.Videoiupsum3.Promolta4.RNS Agency5.Push Views6.Sprizzy?

Description : Who is the best YouTube video promotion company1.Videopromotion.club2.Videoiupsum3.Promolta4.RNS Agency5.Push Views6.Sprizzy?

Last Answer : In my opinion, the best way to promote videos on YouTube is the service lowcostsmm. With its help you can get more views likes and subscribers, and it's safe for your channel. This site can be found by entering the domain into any search engine, such as Google or Bing

“IRNA” is the news agency of: (a) India (b) Iraq (c) Iran (d) None of these

Description : “IRNA” is the news agency of: (a) India (b) Iraq (c) Iran (d) None of these

Last Answer : (c) Iran

What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Description : What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Last Answer : It blocks the binding of amino-acyl tRNA to the A site of ribosomes

What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Description : What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Last Answer : It blocks the binding of amino-acyl tRNA to the A site of ribosomes

Is it true that proteins are made on the ribosomes in the cytoplasm?

Description : Is it true that proteins are made on the ribosomes in the cytoplasm?

Last Answer : Feel Free to Answer

Are ribosomes floating freely in the cytoplasm?

Description : Are ribosomes floating freely in the cytoplasm?

Last Answer : Yes. Ribosomes are found both freely floating and attached tothe endoplasmic reticulum.