What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

What happens at the ribosome in the production of a protein?
a. mRNA brings the codon
b. tRNA brings the anticodon
c. the amino acids are linked by polypeptide bonds
d. translation
e. all the above
by

1 Answer

Answer :

c. the amino acids are linked by polypeptide bonds
by

Related questions

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

.The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon

Description : .The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon

Last Answer : (d) recognition of an anti-codon.

The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon.

Description : The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon.

Last Answer : c) aminoacylation of tRNA

All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA

Description : All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA

Last Answer : Answer : B

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

Degeneracy of genetic code implies that (A) Codons do not code for specific amino acid (B) Multiple codons must decode the same amino acids (C) No anticodon on tRNA molecule (D) Specific codon decodes many amino acids

Description : Degeneracy of genetic code implies that (A) Codons do not code for specific amino acid (B) Multiple codons must decode the same amino acids (C) No anticodon on tRNA molecule (D) Specific codon decodes many amino acids

Last Answer : Answer : B

A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, rather than L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine

Description : A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, ... L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine

Last Answer : C.proteins are synthesized from

A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine

Description : A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine

Last Answer : .proteins are synthesized from D-, rather than L-, isomers of amino acids

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

Point out mRna codon and anticodon when tRna is charged with aminocaid hionine -Biology

Description : Point out mRna codon and anticodon when tRna is charged with aminocaid hionine -Biology

Last Answer : answer:

Point out mRna codon and anticodon when tRna is charged with aminocaid hionine -Biology

Description : Point out mRna codon and anticodon when tRna is charged with aminocaid hionine -Biology

Last Answer : answer:

Site in the ribosome from which the tRNA donates amino acids to the growingpolypeptide chain is A- P site B- O site C- T site D- A site

Description : Site in the ribosome from which the tRNA donates amino acids to the growing polypeptide chain is A- P site B- O site C- T site D- A site

Last Answer : P site

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Last Answer : a) rRNA

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Last Answer : tRNA

During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.

Description : During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.

Last Answer : (c) association of 30S mRNA with formyl-met- tRNA

.During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.

Description : .During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.

Last Answer : (c) association of 30S mRNA with formyl-met- tRNA

The enzyme amino acyl tRNA synthetase is involved in (A) Dissociation of discharged tRNA from 80S ribosome (B) Charging of tRNA with specific amino acids (C) Termination of protein synthesis (D) Nucleophilic attack on esterified carboxyl group of peptidyl tRNA

Description : The enzyme amino acyl tRNA synthetase is involved in (A) Dissociation of discharged tRNA from 80S ribosome (B) Charging of tRNA with specific amino acids (C) Termination of protein synthesis (D) Nucleophilic attack on esterified carboxyl group of peptidyl tRNA

Last Answer : Answer : B

ATP is required for (A) Fusion of 40S and 60S of ribosome (B) Accommodation tRNA amino acid in a site of ribosome (C) Movement of ribosome along mRNA (D) formation of tRNA amino acid complex

Description : ATP is required for (A) Fusion of 40S and 60S of ribosome (B) Accommodation tRNA amino acid in a site of ribosome (C) Movement of ribosome along mRNA (D) formation of tRNA amino acid complex

Last Answer : Answer : D

GTP is not required for (A) Capping L of mRNA (B) Fusion of 40S and 60S of ribosome (C) Accommodation of tRNA amino acid (D) Formation of tRNA amino acid complex

Description : GTP is not required for (A) Capping L of mRNA (B) Fusion of 40S and 60S of ribosome (C) Accommodation of tRNA amino acid (D) Formation of tRNA amino acid complex

Last Answer : Answer : D

The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Description : The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Last Answer : .is located immediately upstream of the start codon

The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Description : The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Last Answer : .is located immediately upstream of the start codon

Chloramphenicol inhibits bacterial protein synthesis by: A. Binding to 30S ribosome and inhibiting attachment of aminoacyl tRNA B. Binding to 50S ribosome and preventing peptide bond formation C. Binding to 50S ribosome and blocking translocation of peptide chain D. Binding to both 30S and 50S ribosome and inducing misreading of mRNA code

Description : Chloramphenicol inhibits bacterial protein synthesis by: A. Binding to 30S ribosome and inhibiting attachment of aminoacyl tRNA B. Binding to 50S ribosome and preventing peptide bond formation C. Binding to ... chain D. Binding to both 30S and 50S ribosome and inducing misreading of mRNA code

Last Answer : B. Binding to 50S ribosome and preventing peptide bond formation

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

The function of a repressor protein in an operon system is to prevent synthesis by binding to (A) The ribosome (B) A specific region of the operon preventing transcription of structural genes (C) The RNA polymerase (D) A specific region of the mRNA preventing translation to protein

Description : The function of a repressor protein in an operon system is to prevent synthesis by binding to (A) The ribosome (B) A specific region of the operon preventing transcription of structural genes (C) The RNA polymerase (D) A specific region of the mRNA preventing translation to protein

Last Answer : Answer : B

Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Description : Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Last Answer : mRNA

Translation results in the formation of (A) mRNA (B) tRNA (C) rRNA (D) A protein molecule

Description : Translation results in the formation of (A) mRNA (B) tRNA (C) rRNA (D) A protein molecule

Last Answer : Answer : D

Translation results in a product known as (A) Protein (B) tRNA (C) mRNA (D) rRNA

Description : Translation results in a product known as (A) Protein (B) tRNA (C) mRNA (D) rRNA

Last Answer : Answer : A

Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Description : Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Last Answer : (c) Repressor protein - Binds to operator to stop enzyme synthesis.

Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Description : Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Last Answer : (d) Operon - Structural genes, operator and promoter

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Is mRNA a codon or anticodon? -Biology

Description : Is mRNA a codon or anticodon? -Biology

Last Answer : answer:

Is mRNA a codon or anticodon? -Biology

Description : Is mRNA a codon or anticodon? -Biology

Last Answer : answer:

The anticodon region is an important part of the structure of (A) rRNA (B) tRNA (C) mRNA (D) hrRNA

Description : The anticodon region is an important part of the structure of (A) rRNA (B) tRNA (C) mRNA (D) hrRNA

Last Answer : Answer : B

Anticodon sequence are seen in (A) tRNA and transcribed DNA strand (B) tRNA and complementary DNA strand (C) mRNA (D) mRNA and complementary DNA strand

Description : Anticodon sequence are seen in (A) tRNA and transcribed DNA strand (B) tRNA and complementary DNA strand (C) mRNA (D) mRNA and complementary DNA strand

Last Answer : Answer : A

Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Description : Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Last Answer : (b) mRNA

Anticodon occurs in (a) tRNA (b) mRNA (c) rRNA (d) DNA.

Description : Anticodon occurs in (a) tRNA (b) mRNA (c) rRNA (d) DNA.

Last Answer : b) mRNA

Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Description : Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Last Answer : tRNA

Anticodon occurs in (a) tRNA (b) mRNA (c) rRNA (d) DNA.

Description : Anticodon occurs in (a) tRNA (b) mRNA (c) rRNA (d) DNA.

Last Answer : (a) tRNA

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Description : A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Last Answer : a. 332

Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Description : Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Last Answer : Answer : D

Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Last Answer : Answer : A

Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (b) tRNA

.Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : .Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (c) mRNA

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape