The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

The interaction between the mRNA and tRNA determined the position of amino acid in
a polypeptide sequence. This is called the
A- stagerivity
B- Wobble hypothesis
C- Promiscuity
D- adaptor hypothesis
by

1 Answer

Answer :

adaptor hypothesis
by

Related questions

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (b) tRNA

.Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : .Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (c) mRNA

Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Description : Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Last Answer : Answer : D

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape

What does the positive strand in double stranded RNA viruses stands for? A- rRNA B- tRNA C- .mRNA D- None of these

Description : What does the positive strand in double stranded RNA viruses stands for? A- rRNA B- tRNA C- .mRNA D- None of these

Last Answer : .mRNA

Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Description : Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Last Answer : mRNA

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Last Answer : a) rRNA

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Last Answer : tRNA

Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Description : Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Last Answer : (d) Streptomycin

.Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Description : .Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Last Answer : (c) Neomycin

ATP is required for (A) Fusion of 40S and 60S of ribosome (B) Accommodation tRNA amino acid in a site of ribosome (C) Movement of ribosome along mRNA (D) formation of tRNA amino acid complex

Description : ATP is required for (A) Fusion of 40S and 60S of ribosome (B) Accommodation tRNA amino acid in a site of ribosome (C) Movement of ribosome along mRNA (D) formation of tRNA amino acid complex

Last Answer : Answer : D

GTP is not required for (A) Capping L of mRNA (B) Fusion of 40S and 60S of ribosome (C) Accommodation of tRNA amino acid (D) Formation of tRNA amino acid complex

Description : GTP is not required for (A) Capping L of mRNA (B) Fusion of 40S and 60S of ribosome (C) Accommodation of tRNA amino acid (D) Formation of tRNA amino acid complex

Last Answer : Answer : D

All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA

Description : All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA

Last Answer : Answer : B

Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Last Answer : Answer : A

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

Wobble hypothesis was given by

Description : Wobble hypothesis was given by

Last Answer : Wobble hypothesis was given by A. F.H.C Crick B. Nirenberg C. Holley D. Khorana

A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, rather than L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine

Description : A characteristic of protein synthesis in both the archaea and eukarya is A.transcription and translation are coupled B.translation is inhibited by diphtheria toxin C.proteins are synthesized from D-, ... L-, isomers of amino acids D.the initiator tRNA is charged with N-formyl- methionine

Last Answer : C.proteins are synthesized from

Site in the ribosome from which the tRNA donates amino acids to the growingpolypeptide chain is A- P site B- O site C- T site D- A site

Description : Site in the ribosome from which the tRNA donates amino acids to the growing polypeptide chain is A- P site B- O site C- T site D- A site

Last Answer : P site

What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Description : What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Last Answer : It blocks the binding of amino-acyl tRNA to the A site of ribosomes

What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Description : What is the action of tetracycline in prokaryotes? A- It blocks translocation reaction on ribosomes B- It blocks peptidyltransferase reaction on ribosomes C- It blocks the binding of amino-acyl tRNA to the A site of ribosomes D- Not known with certainity

Last Answer : It blocks the binding of amino-acyl tRNA to the A site of ribosomes

A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine

Description : A characteristic of protein synthesis in both the archaea and eukarya is A- transcription and translation are coupled B- translation is inhibited by diphtheria toxin C- .proteins are synthesized from D-, rather than L-, isomers of amino acids D- the initiator tRNA is charged with N-formyl-methionine

Last Answer : .proteins are synthesized from D-, rather than L-, isomers of amino acids

eIF-1A and eIF-3 are required (A) For binding of amino acyl tRNA to 40 S ribosomal subunit (B) For binding of mRNA to 40 S ribosomal subunit (C) For binding of 60 S subunit to 40 S subunit (D) To prevent binding of 60 S subunit to 40 S subunit

Description : eIF-1A and eIF-3 are required (A) For binding of amino acyl tRNA to 40 S ribosomal subunit (B) For binding of mRNA to 40 S ribosomal subunit (C) For binding of 60 S subunit to 40 S subunit (D) To prevent binding of 60 S subunit to 40 S subunit

Last Answer : Answer : D

Eukaryotic initiation factors 4A, 4B and 4F bind to (A) 40 S ribosomal subunit (B) 60 S ribosomal subunit (C) mRNA (D) Amino acyl tRNA

Description : Eukaryotic initiation factors 4A, 4B and 4F bind to (A) 40 S ribosomal subunit (B) 60 S ribosomal subunit (C) mRNA (D) Amino acyl tRNA

Last Answer : Answer : C

The newly entering amino acyl tRNA into A site requires (A) EF-II (B) Ribosomal RNA (C) mRNA (D) EF-I

Description : The newly entering amino acyl tRNA into A site requires (A) EF-II (B) Ribosomal RNA (C) mRNA (D) EF-I

Last Answer : Answer : D

Anticodon sequence are seen in (A) tRNA and transcribed DNA strand (B) tRNA and complementary DNA strand (C) mRNA (D) mRNA and complementary DNA strand

Description : Anticodon sequence are seen in (A) tRNA and transcribed DNA strand (B) tRNA and complementary DNA strand (C) mRNA (D) mRNA and complementary DNA strand

Last Answer : Answer : A

The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA

Description : The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA

Last Answer : Answer : C

mRNA is complementary to the nucleotide sequence of (A) Coding strand (B) Ribosomal RNA (C) tRNA (D) Template strand

Description : mRNA is complementary to the nucleotide sequence of (A) Coding strand (B) Ribosomal RNA (C) tRNA (D) Template strand

Last Answer : Answer : A

A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Description : A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Last Answer : a. 332

Which one of the following could NOT cause a change in the mRNA ―reading frame‖? a. Insertion Sequence b. Base-Pair Substitution c. Base Addition d. Base Deletion

Description : Which one of the following could NOT cause a change in the mRNA ―reading frame‖? a. Insertion Sequence b. Base-Pair Substitution c. Base Addition d. Base Deletion

Last Answer : b. Base-Pair Substitution

Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Description : Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Last Answer : (b) mRNA

Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Description : Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).

Last Answer : tRNA

Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- Restriction endonuclease can cleave ss and dsDNA both C- Restriction fragment length polymorphism (RFLP) is usually formed in coding sequenceof a gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Description : Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- Restriction endonuclease can cleave ss and dsDNA both C- Restriction ... sequenceof a gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Last Answer : Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Which of the following sequences has helped in identifying eukaryotes, eubacteria and A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Description : Which of the following sequences has helped in identifying eukaryotes, eubacteria and A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Last Answer : Signature sequence

Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction fragment length polymorphism (RFLP) is usually formed in coding sequence of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Description : Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction ... of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Last Answer : Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction fragment length polymorphism (RFLP) is usually formed in coding sequence of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Description : Which of the following statement is correct? A- The size and sequence of introns can be deduced from the cDNA sequence B- .Restriction endonuclease can cleave ss and dsDNA both C- Restriction ... of a Gene D- Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Last Answer : Amino acid sequence of a protein can be deduced from corresponding cDNA nucleotide

Which of the following sequences has helped in identifying eukaryotes, eubacteria and archeabacterial cell types? A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Description : Which of the following sequences has helped in identifying eukaryotes, eubacteria and archeabacterial cell types? A- Signature sequence B- Signal sequence C- Shine-Dalgarno sequence D- Amino acid sequence

Last Answer : Signature sequence

Triplet sequence found in mRNA which codes for single amino acid

Description : Triplet sequence found in mRNA which codes for single amino acid

Last Answer : Ans. Codon

The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Description : The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Last Answer : a. primary

Wobble position means a) Base paring b) altered base on code b) third altered base on codon d) none of the above

Description : Wobble position means a) Base paring b) altered base on code b) third altered base on codon d) none of the above

Last Answer : b) third altered base on codon

Two cyclic polypeptide antibiotics are a. Vancomycin and streptomycin. b. Penicillin and cephalosporin. c. Bacitracin and polymyxins d. .gentamicin and chloramphenicol

Description : Two cyclic polypeptide antibiotics are a. Vancomycin and streptomycin. b. Penicillin and cephalosporin. c. Bacitracin and polymyxins d. .gentamicin and chloramphenicol

Last Answer : c. Bacitracin and polymyxins

mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Description : mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Last Answer : Answer : A

A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Description : A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Last Answer : Answer : A