Description : Under which of the following conditions there will be no change in the reading frame of following mRNA? 5' AACAGCGGUGCUAUU 3' (a) Deletion of GGU from 7th, 8th and 9th positions (b) Insertion of G ... ) Deletion of G from 5th position (d) Insertion of A and G at 4th and 5th position respectively
Last Answer : (a) Deletion of GGU from 7th, 8th and 9th positions
Description : The codon for phenyl Alanine is (A) AAA (B) CCC (C) GGG (D) UUU
Last Answer : Answer : D
Description : The codon which serves as translation start signal is (A) AUG (B) UAG (C) UGA (D) UAA
Last Answer : Answer : A
Description : AUG, the only identified codon for methionine is important as (A) A releasing factor for peptide chains (B) A chain terminating codon (C) Recognition site on tRNA (D) A chain initiating codon
Description : Using written convertion which one of the following sequences is complimentary to TGGCAGCCT? (A) ACC GTC GGA (B) ACC GUC GGA (C) AGG CTG CCA (D) TGG CTC GGA
Description : If the codon UAC on mRNA changes into UAG as a result of a base substitution in DNA, it will result in (A) Silent mutation (B) Acceptable mis-sense mutation (C) Nonsense mutation (D) Frameshift mutation
Last Answer : Answer : C
Description : eIF-4 B (A) Binds to 3’ chain initiation codon on mRNA (B) Binds to 3’ end of mRNA (C) Binds to 5’ end of mRNA (D) Unwinds mRNA near its 5’ end
Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein
Description : All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA
Last Answer : Answer : B
Description : In the following partial sequence of mRNA, a mutation of the template DNA results in a change in codon 91 to UAA. The type of mutation is 88 89 90 91 92 93 94 GUC GAC CAG UAG GGC UAA CCG (A) Missene (B) Silent (C) Nonsense (D) Frame shit
Description : Is AUG a start codon? -Biology
Last Answer : answer:
Description : Mention two functions of codon AUG -Science
Description : Initiation codon of protein synthesis (in eukaryotes) is (a) GUA (b) GCA (c) CCA (d) AUG.
Last Answer : (a) GUA
Description : Which of the following serves as a terminal codon? (a) UAG (b) AGA (c) AUG (d) GCG
Last Answer : b) AGA
Description : .Initiation codon in eukaryotes is (a) GAU (b) AGU (c) AUG (d) UAG
Last Answer : d) UAG
Description : Which of the following is initiation codon? (a) UAG (b) AUC (c) AUG (d) CCU
Last Answer : b) AUC
Description : Which one of the following is the starter codon? (a) UAA (b) UAG (c) AUG (d) UGA
Last Answer : (c) AUG
Last Answer : (d) AUG.
Last Answer : a) UAG
Description : Initiation codon in eukaryotes is (a) GAU (b) AGU (c) AUG (d) UAG
Description : .Which of the following is initiation codon? (a) UAG (b) AUC (c) AUG (d) CCU
Description : Which of the termination codon is called amber? A- UAA B- UAG C- UGA D- AUG
Last Answer : UAG
Description : The stretch of codons between AUG and a stop codon is called a) open reading frame b) TATA box c) colinearity d) degenerate
Last Answer : a) open reading frame
Description : Where does the mRNA get translated in to protein?
Last Answer : Need answer
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the ... activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.
Last Answer : C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes.
Description : .The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon
Last Answer : (d) recognition of an anti-codon.
Description : The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon.
Last Answer : c) aminoacylation of tRNA
Description : Is mRNA a codon or anticodon? -Biology
Description : Point out mRna codon and anticodon when tRna is charged with aminocaid hionine -Biology
Description : What is not true for genetic code? (a) It is nearly universal. (b) It is degenerate. (c) It is unambiguous. (d) A codon in mRNA is read in a non-contiguous fashion.
Last Answer : (c) It is unambiguous.
Last Answer : d) A codon in mRNA is read in a non-contiguous
Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes
Description : A silent mutation is most likely to result from (A) Substitution of the first base of a codon (B) Substitution of the third base of a codon (C) Conversion of a nonsense codon into a sense codon (D) Conversion of a sense codon into a nonsense codon
Description : Genetic code is said to be degenerate because (A) It can undergo mutations (B) A large proportion of DNA is non-coding (C) One codon can code for more than one amino acids (D) More than one codons can code for the same amino acids
Description : In the process of elongation of chain binding of amino acyl tRNA to the A site requires (A) A proper codon recognition (B) GTP (C) EF-II (D) GDP
Description : Degeneracy of genetic code implies that (A) Codons do not code for specific amino acid (B) Multiple codons must decode the same amino acids (C) No anticodon on tRNA molecule (D) Specific codon decodes many amino acids
Description : Genetic code is (A) Collection of codon (B) Collection of amino acids (C) Collection of purine nucleotide (D) Collection of pyrimidine nucleotide
Description : All the following statement about hydroxyproline are true except (A) There is no codon for hydroxyproline (B) It is present in large amounts in collagen (C) Free proline cannot be hydroxylated to hydroxyproline (D) Hydroxylation of proline residues is catalysed by a dioxygenase
Description : Elongation of a peptide chain involves all the following except (A) mRNA (B) GTP (C) Formyl-Met-tRNA (D) Tu, TS and G factors
Description : Translation results in the formation of (A) mRNA (B) tRNA (C) rRNA (D) A protein molecule
Description : Amanitin the mushroom poison inhibits (A) Glycoprotein synthesis (B) ATP synthesis (C) DNA synthesis (D) mRNA synthesis
Description : mRNA is complementary copy of (A) 5′-3′ strand of DNA+ (B) 3′-5′ strand of DNA (C) Antisense strand of DNA (D) tRNA