Description : In eukaryotes, the 40 S pre-initiation complex contains all the following initiation factors except (A) eIF-1A (B) eIF-2 (C) eIF-3 (D) eIF-4
Last Answer : Answer : D
Description : eIF-1A and eIF-3 are required (A) For binding of amino acyl tRNA to 40 S ribosomal subunit (B) For binding of mRNA to 40 S ribosomal subunit (C) For binding of 60 S subunit to 40 S subunit (D) To prevent binding of 60 S subunit to 40 S subunit
Description : All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA
Last Answer : Answer : B
Description : The enzyme DNA ligase (A) Introduces superhelical twists (B) Connects the end of two DNA chains (C) Unwinds the double helix (D) Synthesises RNA primers
Description : Eukaryotic initiation factors 4A, 4B and 4F bind to (A) 40 S ribosomal subunit (B) 60 S ribosomal subunit (C) mRNA (D) Amino acyl tRNA
Last Answer : Answer : C
Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA
Last Answer : Answer : A
Description : If the codon UAC on mRNA changes into UAG as a result of a base substitution in DNA, it will result in (A) Silent mutation (B) Acceptable mis-sense mutation (C) Nonsense mutation (D) Frameshift mutation
Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein
Description : In the following partial sequence of mRNA, a mutation of the template DNA results in a change in codon 91 to UAA. The type of mutation is 88 89 90 91 92 93 94 GUC GAC CAG UAG GGC UAA CCG (A) Missene (B) Silent (C) Nonsense (D) Frame shit
Description : The first codon to be translated on mRNA is (A) AUG (B) GGU (C) GGA (D) AAA
Description : Initiation codon of protein synthesis (in eukaryotes) is (a) GUA (b) GCA (c) CCA (d) AUG.
Last Answer : (a) GUA
Description : .Initiation codon in eukaryotes is (a) GAU (b) AGU (c) AUG (d) UAG
Last Answer : d) UAG
Description : Which of the following is initiation codon? (a) UAG (b) AUC (c) AUG (d) CCU
Last Answer : b) AUC
Last Answer : (d) AUG.
Description : Initiation codon in eukaryotes is (a) GAU (b) AGU (c) AUG (d) UAG
Last Answer : (c) AUG
Description : .Which of the following is initiation codon? (a) UAG (b) AUC (c) AUG (d) CCU
Description : In pKO1 plasmid, galactose kinase gene is a reporter gene which lacks ___________ gene. a. Initiation codon b. Promoter c. Activator d. Termination
Last Answer : b. Promoter
Description : The part of the cell which binds to the mRNA during protein systhesis is C A. Golgi bodies B. Lysosomes C. Ribosomes D. Food vacuoles
Last Answer : Ribosome
Description : Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.
Last Answer : (c) Repressor protein - Binds to operator to stop enzyme synthesis.
Last Answer : (d) Operon - Structural genes, operator and promoter
Description : Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the ... activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.
Last Answer : C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes.
Description : eIF-4 A possesses (A) ATPase activity (B) GTPase activity (C) Helicase activity (D) None of these
Description : The first amino acyl tRNA approaches 40 S ribosomal subunit in association with (A) eIF-1A and GTP (B) eIF-2 and GTP (C) eIF-2C and GTP (D) eIF-3 and GTP
Description : Erythromycin binds to 50 S ribosomal sub unit and (A) Inhibits binding of amino acyl tRNA (B) Inhibits Peptidyl transferase activity (C) Inhibits translocation (D) Causes premature chain termination
Description : The portion of the immunoglobulin molecule that binds the specific antigen is formed by (A) Variable regions of H and L chains (B) Constant region of H chain (C) Constant region of L chain (D) Hinge region
Description : During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.
Last Answer : (c) association of 30S mRNA with formyl-met- tRNA
Description : .During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.
Description : RNA is composed of strands of nucleotides that are read as a 3 nucleotide codon. These are distinguished by tRNAs that match the codons on one end and carry individual building blocks of a protein chain. What are these building blocks of protein that tRNAs bind?
Last Answer : Amino Acids
Description : Is mRNA a codon or anticodon? -Biology
Last Answer : answer:
Description : Point out mRna codon and anticodon when tRna is charged with aminocaid hionine -Biology
Description : .The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon
Last Answer : (d) recognition of an anti-codon.
Description : What is not true for genetic code? (a) It is nearly universal. (b) It is degenerate. (c) It is unambiguous. (d) A codon in mRNA is read in a non-contiguous fashion.
Last Answer : (c) It is unambiguous.
Description : The first phase of translation is (a) binding of mRNA to ribosome (b) recognition of DNA molecule (c) aminoacylation of tRNA (d) recognition of an anti-codon.
Last Answer : c) aminoacylation of tRNA
Last Answer : d) A codon in mRNA is read in a non-contiguous
Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : In the process of elongation of chain binding of amino acyl tRNA to the A site requires (A) A proper codon recognition (B) GTP (C) EF-II (D) GDP
Description : AUG, the only identified codon for methionine is important as (A) A releasing factor for peptide chains (B) A chain terminating codon (C) Recognition site on tRNA (D) A chain initiating codon
Description : The minimax algorithm computes the minimax decision from the current state. It uses a simple recursive computation of the minimax values of each successor state, directly implementing the defining equations. The ... are backed up through the tree as the recursion unwinds. a) True b) False
Last Answer : a) True
Description : Elongation of a peptide chain involves all the following except (A) mRNA (B) GTP (C) Formyl-Met-tRNA (D) Tu, TS and G factors
Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity
Description : A chain growth polymerisation reaction consists of three different types of reaction namely initiation reaction, propagation reaction & termination reaction. Chain growth polymerisation reaction is not involved ... Siloxane elastomers (B) Polyamides (C) Vinyl polymers (D) Urea-formaldehyde resins
Last Answer : (D) Urea-formaldehyde resins
Description : In contrast to Eukaryotic mRNA, prokaryotic mRNA is characterized by (A) Having 7-methyl guanosine triphosphate at the 5’ end (B) Being polycystronic (C) Being only monocystronic (D) Being synthesized with introns
Description : In RNA moleule ‘Caps’ (A) Allow tRNA to be processed (B) Are unique to eukaryotic mRNA (C) Occur at the 3’ end of tRNA (D) Allow correct translation of prokaryotic mRNA
Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours
Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Select the antibiotic which inhibits bacterial protein synthesis by interfering with translocation of elongating peptide chain from acceptor site back to the peptidyl site of the ribosome so that ... chain is prematurely terminated: A. Chloramphenicol B. Erythromycin C. Tetracycline D. Streptomycin
Last Answer : B. Erythromycin
Description : Chloramphenicol inhibits bacterial protein synthesis by: A. Binding to 30S ribosome and inhibiting attachment of aminoacyl tRNA B. Binding to 50S ribosome and preventing peptide bond formation C. Binding to ... chain D. Binding to both 30S and 50S ribosome and inducing misreading of mRNA code
Last Answer : B. Binding to 50S ribosome and preventing peptide bond formation
Description : Which of the following statement is correct about membrane cholesterol? (A) The hydroxyl group is located near the centre of the lipid layer (B) Most of the cholesterol is in the form ... forms a rigid, planar structure (D) The hydrocarbon chain of cholesterol projects into the extracellular fluid
Last Answer : C