Where does the mRNA get translated in to protein?

Where does the mRNA get translated in to protein?
by

1 Answer

Answer :

Need answer
by

Related questions

Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the cytoplasm. C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.

Description : Which does NOT occur in a cell stimulated by a steroid hormone? A) The steroid hormone enters the cell by crossing the plasma membrane. B) The hormone binds to a receptor molecule in the ... activates certain genes. E) DNA is transcribed, mRNA is translated, and the result is protein synthesis.

Last Answer : C) The second messenger cyclic AMP is stimulated by the hormone-receptor complex. D) The hormone-receptor complex binds the chromatin and activates certain genes.

The first codon to be translated on mRNA is (A) AUG (B) GGU (C) GGA (D) AAA

Description : The first codon to be translated on mRNA is (A) AUG (B) GGU (C) GGA (D) AAA

Last Answer : Answer : A

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

RNA molecules can be broken up into three classes-which type of RNA molecule is translated into a protein sequence?

Description : RNA molecules can be broken up into three classes-which type of RNA molecule is translated into a protein sequence?

Last Answer : Messenger RNA (mRNA). mRNAs are the RNA transcripts that contain protein coding sequences which are translated into protein.

Why is mRNA used in protein synthesis? -Biology

Description : Why is mRNA used in protein synthesis? -Biology

Last Answer : answer:

Where must in mRNA attach before protein production can begin?

Description : Where must in mRNA attach before protein production can begin?

Last Answer : Need answer

Translation results in the formation of (A) mRNA (B) tRNA (C) rRNA (D) A protein molecule

Description : Translation results in the formation of (A) mRNA (B) tRNA (C) rRNA (D) A protein molecule

Last Answer : Answer : D

Polysemes do not contain (A) Protein (B) DNA (C) mRNA (D) rRNA

Description : Polysemes do not contain (A) Protein (B) DNA (C) mRNA (D) rRNA

Last Answer : Answer : B

The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA

Description : The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA

Last Answer : Answer : C

mRNA ready for protein synthesis has the poly _______ toil. (A) G (B) A (C) U (D) C

Description : mRNA ready for protein synthesis has the poly _______ toil. (A) G (B) A (C) U (D) C

Last Answer : Answer : B

The mRNA ready for protein synthesis has the ________ cap. (A) ATP (B) CTP (C) GTP (D) UTP

Description : The mRNA ready for protein synthesis has the ________ cap. (A) ATP (B) CTP (C) GTP (D) UTP

Last Answer : Answer : C

Translation is the formation of (A) DNA from DNA (B) mRNA from DNA (C) Protein through mRNA (D) mRNA from pre mRNA

Description : Translation is the formation of (A) DNA from DNA (B) mRNA from DNA (C) Protein through mRNA (D) mRNA from pre mRNA

Last Answer : Answer : B

Transcription is the formation of (A) DNA from a parent DNA (B) mRNA from a parent mRNA (C) pre mRNA from DNA (D) protein through mRNA

Description : Transcription is the formation of (A) DNA from a parent DNA (B) mRNA from a parent mRNA (C) pre mRNA from DNA (D) protein through mRNA

Last Answer : Answer : C

From DNA the genetic message is transcribed into this compound: (A) Protein (B) mRNA (C) tRNA (D) rRNA

Description : From DNA the genetic message is transcribed into this compound: (A) Protein (B) mRNA (C) tRNA (D) rRNA

Last Answer : Answer : B

For production of eukaryotic protein by recombinant DNA technology in bacteria, the template used is (A) Eukaryotic gene (B) hnRNA (C) mRNA (D) All of these

Description : For production of eukaryotic protein by recombinant DNA technology in bacteria, the template used is (A) Eukaryotic gene (B) hnRNA (C) mRNA (D) All of these

Last Answer : Answer : C

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

Okazaki fragment is related to (A) DNA synthesis (B) Protein synthesis (C) mRNA formation (D) tRNA formation

Description : Okazaki fragment is related to (A) DNA synthesis (B) Protein synthesis (C) mRNA formation (D) tRNA formation

Last Answer : Answer : A

The mushroom poison amanitin is an inhibitor of (A) Protein synthesis (B) mRNA synthesis (C) DNA synthesis (D) Adenosine synthesis

Description : The mushroom poison amanitin is an inhibitor of (A) Protein synthesis (B) mRNA synthesis (C) DNA synthesis (D) Adenosine synthesis

Last Answer : Answer : B

Translation results in a product known as (A) Protein (B) tRNA (C) mRNA (D) rRNA

Description : Translation results in a product known as (A) Protein (B) tRNA (C) mRNA (D) rRNA

Last Answer : Answer : A

Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Last Answer : Answer : A

The function of a repressor protein in an operon system is to prevent synthesis by binding to (A) The ribosome (B) A specific region of the operon preventing transcription of structural genes (C) The RNA polymerase (D) A specific region of the mRNA preventing translation to protein

Description : The function of a repressor protein in an operon system is to prevent synthesis by binding to (A) The ribosome (B) A specific region of the operon preventing transcription of structural genes (C) The RNA polymerase (D) A specific region of the mRNA preventing translation to protein

Last Answer : Answer : B

Genetic information of nuclear DNA is transmitted to the site of protein synthesis by (A) rRNA (B) mRNA (C) tRNA (D) Polysomes

Description : Genetic information of nuclear DNA is transmitted to the site of protein synthesis by (A) rRNA (B) mRNA (C) tRNA (D) Polysomes

Last Answer : D

The process of producing a protein from its DNA- and mRNA-coding sequences.

Description : The process of producing a protein from its DNA- and mRNA-coding sequences.

Last Answer : Ans. Gene expression

An important step in protein synthesis is transcription. Which of the following statement(s) is/are true concerning this process? a. The first step in gene transcription involves separating the double helix of DNA by an enzyme known as DNA polymerase b. The initial product of DNA transcription is called heterogeneous nuclear RNA which codes directly for proteins c. After processing is complete, the mRNA is exported from the nucleus to the cytoplasm d. Only one protein can be produced from an initial mRNA strand

Description : An important step in protein synthesis is transcription. Which of the following statement(s) is/are true concerning this process? a. The first step in gene transcription involves separating the double helix ... nucleus to the cytoplasm d. Only one protein can be produced from an initial mRNA strand

Last Answer : Answer: c Transcription of a gene begins at an initiation site associated with a specific DNA sequence, termed a promoter region. After binding to DNA, the RNA polymerase opens up a short ... different proteins from the same gene. mRNA is exported from the nucleus only after processing is complete

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Description : The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Last Answer : Ans:(d)

The part of the cell which binds to the mRNA during protein systhesis is C A. Golgi bodies B. Lysosomes C. Ribosomes D. Food vacuoles

Description : The part of the cell which binds to the mRNA during protein systhesis is C A. Golgi bodies B. Lysosomes C. Ribosomes D. Food vacuoles

Last Answer : Ribosome

Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Description : Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Last Answer : (c) Repressor protein - Binds to operator to stop enzyme synthesis.

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Last Answer : a) rRNA

Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (b) tRNA

Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Description : Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Last Answer : (d) Streptomycin

The transforming principle of Pneumococcus as found out by Avery, MacLeod and McCarty was (a) mRNA (b) DNA (c) protein (d) polysaccharide. (

Description : The transforming principle of Pneumococcus as found out by Avery, MacLeod and McCarty was (a) mRNA (b) DNA (c) protein (d) polysaccharide. (

Last Answer : (c) protein

Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Description : Which one of the following is wrongly matched? (a) Transcription - Writing information from DNA to tRNA. (b) Translation - Using information in mRNA to make protein. (c) Repressor protein - Binds to operator to stop enzyme synthesis. (d) Operon - Structural genes, operator and promoter.

Last Answer : (d) Operon - Structural genes, operator and promoter

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Last Answer : tRNA

.Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : .Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (c) mRNA

.Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Description : .Which antibiotic inhibits interaction between tRNA and mRNA during bacterial protein synthesis? (a) Tetracycline (b) Erythromycin (c) Neomycin (d) Streptomycin

Last Answer : (c) Neomycin

The transforming principle of Pneumococcus as found out by Avery, MacLeod and McCarty was (a) mRNA (b) DNA (c) protein (d) polysaccharide

Description : The transforming principle of Pneumococcus as found out by Avery, MacLeod and McCarty was (a) mRNA (b) DNA (c) protein (d) polysaccharide

Last Answer : (b) DNA

DNA mRNA C Proposed by Protein A B The figure gives an important concept in the genetic implication of DNA. Fill the blanks A, B and C. (a) A-Maurice Wilkins, B-Transcription, C-Translation (b) A-James Watson, B-Replication, C-Extension (c) A-Erwin Chargaff, B-Translation, C-Replication (d) A-Francis Crick, B-Translation, C-Transcription

Description : DNA mRNA C Proposed by Protein A B The figure gives an important concept in the genetic implication of DNA. Fill the blanks A, B and C. (a) A-Maurice Wilkins, B-Transcription, C-Translation ... c) A-Erwin Chargaff, B-Translation, C-Replication (d) A-Francis Crick, B-Translation, C-Transcription

Last Answer : (d) A-Francis Crick, B-Translation, C-Transcription

The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C. DNA mRNA Proposed by Protein C A B (a) A - Transcription, B -Translation, C - Francis Crick (b) A - Translation, B - Extension, C - Rosalind Franklin (c) A - Transcription, B - Replication, C - James Watson (d) A - Translation, B - Transcription, C - Ervin Chargaff

Description : The diagram shows an important concept in the genetic implication of DNA. Fill in the blanks A to C. DNA mRNA Proposed by Protein C A B (a) A - Transcription, B -Translation, C - Francis Crick (b) ... , B - Replication, C - James Watson (d) A - Translation, B - Transcription, C - Ervin Chargaff

Last Answer : (a) A - Transcription, B -Translation, C - Francis Crick

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Description : Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Last Answer : mRNA

Select the incorrect statement out of the five given below about lac operon when Lactose is present in the medium. a) Gene – A gets transcribed into mRNA which produces β-galactoside permease b) Inducer-Repressor complex is formed c) Lactose inactivates repressor protein d) RNA polymerase transcribe Z-gene, Y-gene and A-gene e) Allolactose is the inducer of lac operon

Description : Select the incorrect statement out of the five given below about lac operon when Lactose is present in the medium. a) Gene - A gets transcribed into mRNA which produces β-galactoside permease b) ... polymerase transcribe Z-gene, Y-gene and A-gene e) Allolactose is the inducer of lac operon

Last Answer : Gene – A gets transcribed into mRNA which produces β-galactoside permease b) Inducer-Repressor complex is formed

Select the antibiotic which inhibits bacterial protein synthesis by interfering with translocation of elongating peptide chain from acceptor site back to the peptidyl site of the ribosome so that ribosome does not move along the mRNA and the peptide chain is prematurely terminated: A. Chloramphenicol B. Erythromycin C. Tetracycline D. Streptomycin

Description : Select the antibiotic which inhibits bacterial protein synthesis by interfering with translocation of elongating peptide chain from acceptor site back to the peptidyl site of the ribosome so that ... chain is prematurely terminated: A. Chloramphenicol B. Erythromycin C. Tetracycline D. Streptomycin

Last Answer : B. Erythromycin

Chloramphenicol inhibits bacterial protein synthesis by: A. Binding to 30S ribosome and inhibiting attachment of aminoacyl tRNA B. Binding to 50S ribosome and preventing peptide bond formation C. Binding to 50S ribosome and blocking translocation of peptide chain D. Binding to both 30S and 50S ribosome and inducing misreading of mRNA code

Description : Chloramphenicol inhibits bacterial protein synthesis by: A. Binding to 30S ribosome and inhibiting attachment of aminoacyl tRNA B. Binding to 50S ribosome and preventing peptide bond formation C. Binding to ... chain D. Binding to both 30S and 50S ribosome and inducing misreading of mRNA code

Last Answer : B. Binding to 50S ribosome and preventing peptide bond formation

Have you read any translated literature recently?

Description : Have you read any translated literature recently?

Last Answer : Interesting question. I haven't recently completed a translated work, but I have one in progress: Godsong, a new verse translation of the Bhagavad-Gita, by Amit Majmudar. As it happens, I've ... author has to speak to us through an intermediary instead of addressing us directly. Why do you ask?

How could be translated the following kanji from Japanese to English?

Description : How could be translated the following kanji from Japanese to English?

Last Answer : I’m assuming you mean 東方八犬異聞? Eight dogs of the east?

In the Dragon Ball manga, why 如意棒 is sometimes translated as "mind stick"?

Description : In the Dragon Ball manga, why 如意棒 is sometimes translated as "mind stick"?

Last Answer : according to this the original name means “Staff That Obeys One’s Will”

In the dragon ball franchise, why 筋斗雲 is sometimes translated as "golden fighting cloud" instead of "somersault cloud"?

Description : In the dragon ball franchise, why 筋斗雲 is sometimes translated as "golden fighting cloud" instead of "somersault cloud"?

Last Answer : answer:Because using the same word repeatedly gets boring? It’s a golden cloud from which Son Goku fights. It isn’t inaccurate.

How would the idiom "Train Wreck" be translated into French and maintain its meaning?

Description : How would the idiom "Train Wreck" be translated into French and maintain its meaning?

Last Answer : Still kinda looking for someone fluent in other languages than English. We had another meeting today that could have been an email. I’m just glad I’m not in charge.

Regarding texting: If you could speak the words into your phone, and your phone translated it to text, do you think texting would be as popular as it is?

Description : Regarding texting: If you could speak the words into your phone, and your phone translated it to text, do you think texting would be as popular as it is?

Last Answer : I think speaking the words and having them transferred could be beneficial in some situations and some phones already have that capability. Typing it offers more privacy because no one over hears what you are saying, which has it’s advantages as well.