Description : Which one of the following triplet codes, is correctly matched with its specificity for an amino acid in protein synthesis or as ‘start’ or ‘stop’ codon? (a) UCG – Start (b) UUU – Stop (c) UGU – Leucine (d) UAC – Tyrosine
Last Answer : (d) UAC – Tyrosine
Description : Triplet sequence in t-RNA
Last Answer : Ans. Anticodon
Description : Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.
Last Answer : (b) tRNA
Description : .Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.
Last Answer : (c) mRNA
Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis
Last Answer : adaptor hypothesis
Description : Anticodon is an unpaired triplet of bases in an exposed position of (a) tRNA (b) mRNA (c) rRNA (d) both (b) and (c).
Last Answer : (b) mRNA
Last Answer : tRNA
Description : A DNA sequence that codes for a specific polypeptide
Last Answer : Ans. Cistron
Description : Which triplet in DNA codes for valine ? A. CTT B. AGU C. CAT D. AAT E. None of these (Answer)
Last Answer : E. None of these (Answer)
Description : .In the genetic dictionary, there are 64 codons as (a) 64 amino acids are to be coded (b) 64 types of tRNAs are present (c) there are 44 nonsense codons and 20 sense codons (d) genetic code is triplet.
Last Answer : (c) there are 44 nonsense codons and 20 sense codons
Description : In the genetic dictionary, there are 64 codons as (a) 64 amino acids are to be coded (b) 64 types of tRNAs are present (c) there are 44 nonsense codons and 20 sense codons (d) genetic code is triplet
Last Answer : genetic code is triplet
Description : What is the process that uses mRNA and amino acid to make proteins called?
Last Answer : What is the answer ?
Description : ATP is required for (A) Fusion of 40S and 60S of ribosome (B) Accommodation tRNA amino acid in a site of ribosome (C) Movement of ribosome along mRNA (D) formation of tRNA amino acid complex
Last Answer : Answer : D
Description : GTP is not required for (A) Capping L of mRNA (B) Fusion of 40S and 60S of ribosome (C) Accommodation of tRNA amino acid (D) Formation of tRNA amino acid complex
Description : All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA
Last Answer : Answer : B
Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA
Last Answer : Answer : A
Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours
Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis
Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.
Last Answer : a) rRNA
Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA
Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid
Last Answer : amino acid is bound to tRNA
Description : The process of producing a protein from its DNA- and mRNA-coding sequences.
Last Answer : Ans. Gene expression
Description : A library composed of complementary copies of cellular mRNA
Last Answer : Ans. cDNA
Description : Pulses are deficient in amino acid
Last Answer : Ans. Methionine
Description : Cereals are deficient in amino acid
Last Answer : Ans. Lysine
Description : Protein that contains only amino acid
Last Answer : Ans. Simple protein
Description : The polymers of amino acid
Last Answer : Ans. Proteins and enzymes
Description : An important step in protein synthesis is transcription. Which of the following statement(s) is/are true concerning this process? a. The first step in gene transcription involves separating the double helix ... nucleus to the cytoplasm d. Only one protein can be produced from an initial mRNA strand
Last Answer : Answer: c Transcription of a gene begins at an initiation site associated with a specific DNA sequence, termed a promoter region. After binding to DNA, the RNA polymerase opens up a short ... different proteins from the same gene. mRNA is exported from the nucleus only after processing is complete
Description : In RNA, a string of 3 bases codes for each amino acid. What is the string of bases called?
Last Answer : a condon
Description : Which amino acid is specified by genetic codes ACU, ACC, ACA, ACG showing degeneracy ?
Last Answer : Which amino acid is specified by genetic codes ACU, ACC, ACA, ACG showing degeneracy ? A. Leucine B. Methionine C. Glycine D. Threonine
Description : A segment of DNA that codes for a specific characters
Last Answer : Ans. Gene
Description : eIF-1A and eIF-3 are required (A) For binding of amino acyl tRNA to 40 S ribosomal subunit (B) For binding of mRNA to 40 S ribosomal subunit (C) For binding of 60 S subunit to 40 S subunit (D) To prevent binding of 60 S subunit to 40 S subunit
Description : Eukaryotic initiation factors 4A, 4B and 4F bind to (A) 40 S ribosomal subunit (B) 60 S ribosomal subunit (C) mRNA (D) Amino acyl tRNA
Last Answer : Answer : C
Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein
Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol
Description : The newly entering amino acyl tRNA into A site requires (A) EF-II (B) Ribosomal RNA (C) mRNA (D) EF-I
Description : The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes
Last Answer : Ans:(d)
Description : A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999
Last Answer : a. 332
Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Sequence of AAT GCT TAG GCA on template segment of DNA will be represented over the transcribed mRNA as
Last Answer : Sequence of AAT GCT TAG GCA on template segment of DNA will be represented over the transcribed mRNA as A. ... C. UUA CGA AUC CGU D. TTA CGA ATC CGT
Description : What is the mRNA sequence if the DNA sequence is GATCCT?
Last Answer : Need answer
Description : What is the complimentary mRNA sequence of codons for t-a-c-a-g-g?
Last Answer : Before we look at the complimentary mRNA sequence of the givenDNA sequence, let us remember that RNA contains uracil (U) in placeof Thiamine (T)The querry sequence is:t-a-c-c-t-c-g-c-a-a-c-tSo the mRNA sequence would be:A U G G A G C G U U G A
Description : What is the mRNA sequence of T A C A C C T T G G C G A C G A C T?
Last Answer : The mRNA sequence of t-a-c-a-t-c-t-t-g-g-c-g-a-c-g-a-c-t isUTGTUGUUCCGCTGCTGU.
Description : A part of an mrna has the base sequence gca. which change to this sequence would indicate a missense mutation?
Last Answer : A missense mutation is the change in a single nucleotide that results in a different amino acid being coded for. GCA codes for the amino acid Alanine. Therefore any of the following changes would be missense ... acid GUA -> Valine GGA -> Glycine CCA -> Proline UCA -> Serine ACA -> Threonine
Description : Anticodon sequence are seen in (A) tRNA and transcribed DNA strand (B) tRNA and complementary DNA strand (C) mRNA (D) mRNA and complementary DNA strand
Description : The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA
Description : In the following partial sequence of mRNA, a mutation of the template DNA results in a change in codon 91 to UAA. The type of mutation is 88 89 90 91 92 93 94 GUC GAC CAG UAG GGC UAA CCG (A) Missene (B) Silent (C) Nonsense (D) Frame shit