What is the process that uses mRNA and amino acid to make proteins called?

What is the process that uses mRNA and amino acid to make proteins called?
by

1 Answer

Answer :

What is the answer ?
by

Related questions

Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Last Answer : Answer : C

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA.

Last Answer : a) rRNA

The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Description : The RNA that pick up specific amino acid from amino acid pool in the cytoplasm to ribosome during protein synthesis is called (a) rRNA (b) RNA (c) mRNA (d) tRNA

Last Answer : tRNA

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

An important step in protein synthesis is transcription. Which of the following statement(s) is/are true concerning this process? a. The first step in gene transcription involves separating the double helix of DNA by an enzyme known as DNA polymerase b. The initial product of DNA transcription is called heterogeneous nuclear RNA which codes directly for proteins c. After processing is complete, the mRNA is exported from the nucleus to the cytoplasm d. Only one protein can be produced from an initial mRNA strand

Description : An important step in protein synthesis is transcription. Which of the following statement(s) is/are true concerning this process? a. The first step in gene transcription involves separating the double helix ... nucleus to the cytoplasm d. Only one protein can be produced from an initial mRNA strand

Last Answer : Answer: c Transcription of a gene begins at an initiation site associated with a specific DNA sequence, termed a promoter region. After binding to DNA, the RNA polymerase opens up a short ... different proteins from the same gene. mRNA is exported from the nucleus only after processing is complete

ATP is required for (A) Fusion of 40S and 60S of ribosome (B) Accommodation tRNA amino acid in a site of ribosome (C) Movement of ribosome along mRNA (D) formation of tRNA amino acid complex

Description : ATP is required for (A) Fusion of 40S and 60S of ribosome (B) Accommodation tRNA amino acid in a site of ribosome (C) Movement of ribosome along mRNA (D) formation of tRNA amino acid complex

Last Answer : Answer : D

GTP is not required for (A) Capping L of mRNA (B) Fusion of 40S and 60S of ribosome (C) Accommodation of tRNA amino acid (D) Formation of tRNA amino acid complex

Description : GTP is not required for (A) Capping L of mRNA (B) Fusion of 40S and 60S of ribosome (C) Accommodation of tRNA amino acid (D) Formation of tRNA amino acid complex

Last Answer : Answer : D

All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA

Description : All the following statements about tRNA are correct except (A) A given tRNA can be charged with only one particular amino acid (B) The amino acid is recognized by the anticodon of tRNA (C) The amino acid is attached to end of tRNA (D) The anticodon of tRNA finds the complementary codon on mRNA

Last Answer : Answer : B

Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Last Answer : Answer : A

Triplet sequence found in mRNA which codes for single amino acid

Description : Triplet sequence found in mRNA which codes for single amino acid

Last Answer : Ans. Codon

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (b) tRNA

.Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : .Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (c) mRNA

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Description : During amino acid activation a(n) A-amino acid is bound to tRNA B- amino acid is bound to mRNA C-methyl group is attached to rRNA D-methyl group is attached to an amino acid

Last Answer : amino acid is bound to tRNA

What process of the information carried by mRNA is used to produce proteins?

Description : What process of the information carried by mRNA is used to produce proteins?

Last Answer : Need answer

eIF-1A and eIF-3 are required (A) For binding of amino acyl tRNA to 40 S ribosomal subunit (B) For binding of mRNA to 40 S ribosomal subunit (C) For binding of 60 S subunit to 40 S subunit (D) To prevent binding of 60 S subunit to 40 S subunit

Description : eIF-1A and eIF-3 are required (A) For binding of amino acyl tRNA to 40 S ribosomal subunit (B) For binding of mRNA to 40 S ribosomal subunit (C) For binding of 60 S subunit to 40 S subunit (D) To prevent binding of 60 S subunit to 40 S subunit

Last Answer : Answer : D

Eukaryotic initiation factors 4A, 4B and 4F bind to (A) 40 S ribosomal subunit (B) 60 S ribosomal subunit (C) mRNA (D) Amino acyl tRNA

Description : Eukaryotic initiation factors 4A, 4B and 4F bind to (A) 40 S ribosomal subunit (B) 60 S ribosomal subunit (C) mRNA (D) Amino acyl tRNA

Last Answer : Answer : C

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

The newly entering amino acyl tRNA into A site requires (A) EF-II (B) Ribosomal RNA (C) mRNA (D) EF-I

Description : The newly entering amino acyl tRNA into A site requires (A) EF-II (B) Ribosomal RNA (C) mRNA (D) EF-I

Last Answer : Answer : D

The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Description : The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Last Answer : Ans:(d)

A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Description : A prokaryotic mRNA that consists of 999 nucleotides will code for how many amino acids? a. 332 b. 333 c. 666 d. 999

Last Answer : a. 332

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Biochemically the ribosome consists of _______________ and some 50 structural . (A) mRNA, Carbohydrates (B) tRNA, lipids (C) mRNA, Proteins (D) rRNA, Proteins

Description : Biochemically the ribosome consists of _______________ and some 50 structural . (A) mRNA, Carbohydrates (B) tRNA, lipids (C) mRNA, Proteins (D) rRNA, Proteins

Last Answer : (D) rRNA, Proteins

The linear arrangement of amino acid units in proteins is called : (a) primary structure (b) secondary structure (c) tertiary structure (d) quaternary structure

Description : The linear arrangement of amino acid units in proteins is called : (a) primary structure (b) secondary structure (c) tertiary structure (d) quaternary structure

Last Answer : primary structure

Enzyme catalyzed hydrolysis of proteins produces amino acid of the form (A) D (B) DL (C) L (D) Racemic

Description : Enzyme catalyzed hydrolysis of proteins produces amino acid of the form (A) D (B) DL (C) L (D) Racemic

Last Answer : Answer : C

For biosynthesis of proteins (A) Amino acids only are required (B) Amino acids and nucleic acids only are required (C) Amino acid, nucleic acids and ATP only are required (D) Amino acids, nucleic acids, ATP, GTP, enzymes and activators are required

Description : For biosynthesis of proteins (A) Amino acids only are required (B) Amino acids and nucleic acids only are required (C) Amino acid, nucleic acids and ATP only are required (D) Amino acids, nucleic acids, ATP, GTP, enzymes and activators are required

Last Answer : Answer : D

Bence-Jones proteins possess all the following properties except (A) They are dimers of light chains (B) Their amino acids sequences are identical (C) Their N-terminal halves have variable amino acid sequences (D) Their C-terminal halves have constant amino acid sequences

Description : Bence-Jones proteins possess all the following properties except (A) They are dimers of light chains (B) Their amino acids sequences are identical (C) Their N-terminal halves have variable amino acid sequences (D) Their C-terminal halves have constant amino acid sequences

Last Answer : Answer : B

The limiting amino acid of fish proteins is (A) Tryptophan (B) Cysteine (C) Lysine (D) Threonine

Description : The limiting amino acid of fish proteins is (A) Tryptophan (B) Cysteine (C) Lysine (D) Threonine

Last Answer : Answer : A

A limiting amino acid is an essential amino acid (A) That is most deficient in proteins (B) That is most excess in proteins (C) That which increases the growth (D) That which increases the weight gain

Description : A limiting amino acid is an essential amino acid (A) That is most deficient in proteins (B) That is most excess in proteins (C) That which increases the growth (D) That which increases the weight gain

Last Answer : Answer : A

An amino acid not found in proteins is (A) β-Alanine (B) Proline (C) Lysine (D) Histidine

Description : An amino acid not found in proteins is (A) β-Alanine (B) Proline (C) Lysine (D) Histidine

Last Answer : Answer : A

An example of α-amino acid not present in proteins but essential in mammalian metabolism is (A) 3-Amino 3-hydroxypropanoic acid (B) 2-Amino 3-hydroxybutanoic acid (C) 2-Amino 4-mercaptobutanoic acid (D) 2-Amino 3-mercaptopropanoic acid

Description : An example of α-amino acid not present in proteins but essential in mammalian metabolism is (A) 3-Amino 3-hydroxypropanoic acid (B) 2-Amino 3-hydroxybutanoic acid (C) 2-Amino 4-mercaptobutanoic acid (D) 2-Amino 3-mercaptopropanoic acid

Last Answer : Answer : C

Which of the following statement(s) is/are true concerning protein/amino acid metabolism in man? a. The major source of amino acids is breakdown of circulating proteins b. The recommended daily allowance for protein may triple in critically ill patients c. Urinary nitrogen losses will approach 0 in the face of protein starvation d. Negative nitrogen balance refers to a decrease in nitrogen taken into the body versus the amount of nitrogen lost

Description : Which of the following statement(s) is/are true concerning protein/amino acid metabolism in man? a. The major source of amino acids is breakdown of circulating proteins b. The recommended daily ... balance refers to a decrease in nitrogen taken into the body versus the amount of nitrogen lost

Last Answer : Answer: b, d About 15% of the total body weight is made up of proteins, about half of which are intracellular and half extracellular. In man and other animals, dietary protein is the source of ... is exceeded by the amount of nitrogen lost in the urine, stool, skin, wounds, and fistula drainage

Complete hydrolysis of proteins produces : (a) Ammonia and carbon dioxide (b) Urea and uric acid (c) A mixture of amino acids (d) Glycogen and a fatty acid

Description : Complete hydrolysis of proteins produces : (a) Ammonia and carbon dioxide (b) Urea and uric acid (c) A mixture of amino acids (d) Glycogen and a fatty acid

Last Answer : A mixture of amino acids

Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Description : Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Last Answer : formylmethionine

Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Description : Which of the following modified amino acid is used at the starting of most prokaryotic proteins? A- N-formylserine B- -formylmethionine C- N-formylleucine D-.N-formylalanine

Last Answer : formylmethionine

Typically proteins do not work in their simple amino acid chain structure but instead fold and form shapes that help in their function. Which of the structures is described as being in alpha helices and beta sheets?

Description : Typically proteins do not work in their simple amino acid chain structure but instead fold and form shapes that help in their function. Which of the structures is described as being in alpha helices and beta sheets?

Last Answer : Secondary Protein Structure

An example of -amino acid not present in proteins but essential in mammalian metabolism is (A) 3-Amino 3-hydroxypropanoic acid (B) 2-Amino 3-hydroxybutanoic acid (C) 2-Amino 4-mercaptobutanoic acid (D) 2-Amino 3-mercaptopropanoic acid

Description : An example of -amino acid not present in proteins but essential in mammalian metabolism is (A) 3-Amino 3-hydroxypropanoic acid (B) 2-Amino 3-hydroxybutanoic acid (C) 2-Amino 4-mercaptobutanoic acid (D) 2-Amino 3-mercaptopropanoic acid

Last Answer : (C) 2-Amino 4-mercaptobutanoic acid

Proteins are finally converted into: (a) Glucose (b) Amino acid (c) Glycerol (d) Fatty acid

Description : Proteins are finally converted into: (a) Glucose (b) Amino acid (c) Glycerol (d) Fatty acid

Last Answer : (b) Amino acid

Aspartate amino transferase uses the following for transamination: (A) Glutamic acid and pyruvic acid (B) Glutamic acid and oxaloacetic acid (C) Aspartic acid and pyruvic acid (D) aspartic acid and keto adipic acid

Description : Aspartate amino transferase uses the following for transamination: (A) Glutamic acid and pyruvic acid (B) Glutamic acid and oxaloacetic acid (C) Aspartic acid and pyruvic acid (D) aspartic acid and keto adipic acid

Last Answer : Answer : B

Why are two samples of proteins having an identical composition of amino acids still different?

Description : Why are two samples of proteins having an identical composition of amino acids still different?

Last Answer : I would guess that two proteins with the same sequences of amino acids might be folded in different ways giving them different properties.

How do amino acids form themselves into proteins?

Description : How do amino acids form themselves into proteins?

Last Answer : answer:Here is a link that explains a few things. one of the things it states is: To form protein, the amino acids are linked by dehydration synthesis to form peptide bonds. The chain of ... they conduct and experiment where amino acids and proteins are created by mixing gases. I hope it helps.

What is the peptide bond that connects amino acids in proteins? -Biology

Description : What is the peptide bond that connects amino acids in proteins? -Biology

Last Answer : answer:

Which one of the following amino acids is not found in proteins ?

Description : Which one of the following amino acids is not found in proteins ?

Last Answer : Which one of the following amino acids is not found in proteins ? A. Arginine B. Ornithine C. Aspartic acid D. Tyrosine

Proteins are broken down into amino acids in -

Description : Proteins are broken down into amino acids in -

Last Answer : Proteins are broken down into amino acids in - A. Buccal cavity B. Stomach C. Intestine D. Rectum

Energy for activation of amino acids during proteins synthesis comes from

Description : Energy for activation of amino acids during proteins synthesis comes from

Last Answer : Energy for activation of amino acids during proteins synthesis comes from A. ATP B. GTP C. CTP D. UTP

Selectins are proteins that can recognise specific (A) Carbohydrates (B) Lipids (C) Amino acids (D) Nucleotides

Description : Selectins are proteins that can recognise specific (A) Carbohydrates (B) Lipids (C) Amino acids (D) Nucleotides

Last Answer : Answer : A

Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes

Description : Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes

Last Answer : Answer : C

Phrynoderma is a deficiency of (A) Essential fatty acids(B) Proteins (C) Amino acids (D) None of these

Description : Phrynoderma is a deficiency of (A) Essential fatty acids(B) Proteins (C) Amino acids (D) None of these

Last Answer : Answer : A