Description : Erythromycin binds to 50 S ribosomal sub unit and (A) Inhibits binding of amino acyl tRNA (B) Inhibits Peptidyl transferase activity (C) Inhibits translocation (D) Causes premature chain termination
Last Answer : Answer : C
Description : Streptomycin prevents synthesis of polypeptide by (A) Inhibiting initiation process (B) Releasing premature polypeptide (C) Inhibiting peptidyl transferase activity (D) Inhibiting translocation
Last Answer : Answer : A
Description : Chloramphenicol inhibits bacterial protein synthesis by: A. Binding to 30S ribosome and inhibiting attachment of aminoacyl tRNA B. Binding to 50S ribosome and preventing peptide bond formation C. Binding to ... chain D. Binding to both 30S and 50S ribosome and inducing misreading of mRNA code
Last Answer : B. Binding to 50S ribosome and preventing peptide bond formation
Description : Select the antibiotic which inhibits bacterial protein synthesis by interfering with translocation of elongating peptide chain from acceptor site back to the peptidyl site of the ribosome so that ... chain is prematurely terminated: A. Chloramphenicol B. Erythromycin C. Tetracycline D. Streptomycin
Last Answer : B. Erythromycin
Description : Peptidyl transferase activity of 50 S ribosomal subunits is inhibited by (A) Rifampicin (B) Cycloheximide (C) Chloramphenicol (D) Erythromycin
Description : All of the following statements about puromycin are true except (A) It is an alanyl tRNA analogue (B) It causes premature termination of protein synthesis (C) It inhibits protein synthesis in prokaryotes (D) It inhibits protein synthesis in eukaryotes
Description : After formation of a peptide bond, mRNA is translocated along the ribosome by (A) eEF-1 and GTP (B) eEF-2 and GTP (C) Peptidyl transferase and GTP (D) Peptidyl transferase and ATP
Last Answer : Answer : B
Description : Puromycin causes premature chain termination in (A) Prokaryotes (B) Eukaryotes (C) Both (A) and (B) (D) None of these
Description : mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only
Description : Peptidyl transferase activity is present in (A) 40 S ribosomal subunit (B) 60 S ribosomal subunit (C) eEF-2 (D) Amino acyl tRNA
Description : Peptidyl transferase activity is located in (A) Elongation factor (B) A charged tRNA molecule (C) Ribosomal protein (D) A soluble cytosolic protein
Description : Erythromycin acts on ribosomes and inhibit (A) Formation of initiation complex (B) Binding of aminoacyl tRNA (C) Peptidyl transferase activity (D) Translocation
Last Answer : Answer : D
Description : The α-amino group of the new amino acyl tRNA in the A site carries out a nucleophilic attack on the esterified carboxyl group of the peptidyl tRNA occupying the P site. This reaction is catalysed by (A) DNA polymerase (B) RNA polymerase (C) Peptidyl transferase (D) DNA ligase
Description : Which of the following molecule catalyzes the transpeptidation reaction? A.RNA polymerase B.Peptidyl transferase C.DNA ligase D.DNA polymerase
Last Answer : B.Peptidyl transferase
Description : Ciprofloxacin inhibits the synthesis of (A) DNA in prokaryotes (B) DNA in prokaryotes and eukaryotes (C) RNA in prokaryotes (D) RNA in prokaryotes and eukaryotes
Description : α-Amanitin inhibits (A) DNA polymerase II of prokaryotes (B) DNA polymerase α of eukaryotes (C) RNA polymerase II of eukaryotes (D) RNA-dependent DNA polymerase
Description : Translocation of the newly formed peptidyl tRNA at the A site into the empty P site involves (A) EF-II, GTP (B) EF-I, GTP (C) EF-I, GDP (D) Peptidyl transferase, GTP
Description : Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA
Description : Binding of formylmehtionyl tRNA to 30 S ribosomal subunit of prokaryotes is inhibited by (A) Streptomycin (B) Chloramphenicol (C) Erythromycin (D) Mitomycin
Description : Amanitin the mushroom poison inhibits (A) Glycoprotein synthesis (B) ATP synthesis (C) DNA synthesis (D) mRNA synthesis
Description : Ciprofloxacin inhibits the synthesis of (A) DNA (B) mRNA (C) tRNA (D) rRNA
Description : Novobicin inhibits the synthesis of (A) DNA (B) mRNA (C) tRNA (D) rRNA
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Which of the following step of translation does not consume a high energy phosphate bond? (a) Peptidyl transferase reaction (b) Aminoacyl tRNA binding to A-site (c) Translocation (d) Amino acid activation
Last Answer : (b) Aminoacyl tRNA binding to A-site
Last Answer : (a) Peptidyl transferase reaction
Description : Peptidyl transferase a) Is a 23s rRNA b) forms peptide bonds c) component of ribosome d) all the three
Last Answer : d) all the three
Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape
Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape
Last Answer : aid a newly synthesized polypeptide in folding to its proper shape
Description : A premature neonate suffered respiratory distress and was given an antibiotic 100 mg/kg/day orally. Over the next two days his condition worsened, he become dull, stopped feeding, developed ... most likely antibiotic given to him: A. Ampicillin B. Chloramphenicol C. Erythromycin D. Ciprofloxacin
Last Answer : B. Chloramphenico
Description : In eukaryotic cells (A) Formylated tRNA is important for initiation of translation (B) Cyclohexamide blocks elongation during translation (C) Cytosolic ribosomes are smaller than those found in prokaryotes (D) Erythromycin inhibits elongation during translation
Description : The mechanism of antibacterial action of tetracycline involves (a) Binding to a component of the 50S ribosomal subunit (b) Inhibition of translocase activity (c) Blockade of binding of ... (d) Selective inhibition of ribosomal peptidyl transferases (e) Inhibition of DNA-dependent RNA polymerase
Last Answer : Ans: C
Description : In the synthetic pathway of epinephrine, disulfiram (antabuse) inhibits the enzyme: (A) Tyrosine hydroxylase (B) Dopamine β-hydroxylase (C) DOPA decarboxylase (D) N-methyl transferase
Description : Two cyclic polypeptide antibiotics are a. Vancomycin and streptomycin. b. Penicillin and cephalosporin. c. Bacitracin and polymyxins d. .gentamicin and chloramphenicol
Last Answer : c. Bacitracin and polymyxins
Description : The most important mechanism by which gram negative bacilli acquire chloramphenicol resistance is (a) Decreased permeability into the bacterial cell (b) Acquisition of a plasmid encoded ... bacterial ribosome for chloramphenicol (d) Switching over from ribosomal to mitochondrial protein synthesis
Last Answer : Ans: B
Description : The most important mechanism by which gram negative bacilli acquire chloramphenicol resistance is: A. Decreased permeability into the bacterial cell B. Acquisition of a plasmid encoded ... the bacterial ribosome for chloramphenicol D. Switching over from ribosomal to mitochondrial protein synthesi
Last Answer : B. Acquisition of a plasmid encoded for chloramphenicol acetyl transferas
Description : A polycistronic mRNA can be seen in (A) Prokaryotes (B) Eukaryotes (C) Mitochondria (D) All of these
Description : A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides
Description : All of the following statements about hypoglycin are true except (A) It is a plant toxin (B) It causes hypoglycaemia (C) It inhibits oxidation of short chain fatty acids (D) It inhibits oxidation of long chain fatty acids
Description : Acute pancreatitis is characterised by (A) Lack of synthesis of zymogen enzymes (B) Continuous release of zymogen enzymes into the gut (C) Premature activation of zymogen enzymes (D) Inactivation of zymogen enzymes
Description : A group of genes whose activity is coordinated by a DNA site is – (1) operon (2) cistron (3) polysome (4) polypeptide
Last Answer : (1) operon Explanation: The operon is defined as a group of genes whose activity is coordinated by a DNA site. An operon is a functioning unit of genomic DNA containing a cluster ... together in the cytoplasm, or undergo trans-splicing to create monocistronic mR-NAs that are translated separately.
Description : A group of genes whose activity is coordinated by a DNA site is called: (1) operon (2) cistron (3) polysome (4) polypeptide
Last Answer : operon
Description : During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.
Last Answer : (c) association of 30S mRNA with formyl-met- tRNA
Description : .During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.
Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.
Last Answer : (b) polyhedral bodies
Last Answer : polysome
Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis
Last Answer : adaptor hypothesis
Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome
Last Answer : (1) Polysome
Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine
Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin