What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

What would happen if in a gene encoding a
polypeptide of 50 amino acids, 25th codon (UAU) is
mutated to UAA?
(a) A polypeptide of 24 amino acids will be formed.
(b) Two polypeptides of 24 and 25 amino acids will
be formed.
(c) A polypeptide of 49 amino acids will be formed.
(d) A polypeptide of 25 amino acids will be formed.
by

1 Answer

Answer :

(b) Two polypeptides of 24 and 25 amino acids will
be formed.
by

Related questions

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Description : The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Last Answer : .is located immediately upstream of the start codon

The rivosome binding site A- forms a sltem- loop structure in the RNA B- is located upstream of the promoter sequence C- is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Description : The rivosome binding site A- forms a sltem- loop structure in the RNA B- is located upstream of the promoter sequence C- is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Last Answer : is located immediately upstream of the start codon

The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Description : The ribosome binding site A- forms a stem-loop structure in the RNA B- is located upstream of the promoter sequence C- .is located immediately upstream of the start codon D- is more likely to be associated with an operon than with a gene encoding a single protein

Last Answer : .is located immediately upstream of the start codon

Polymers of more than 100 amino acids are termed (A) Proteins (B) Polypeptides (C) Both (A) and (B) (D) None of these

Description : Polymers of more than 100 amino acids are termed (A) Proteins (B) Polypeptides (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

Which statement is NOT true about non-steroid (peptide) hormones? A) They are derived from peptides, proteins, polypeptides, and derivatives of amino acids. B) They bind to receptors on the cell surface. C) They form cyclic AMP inside the cell. D) They create an enzyme cascade effect. E) They enter the cell in order to have an effect.

Description : Which statement is NOT true about non-steroid (peptide) hormones? A) They are derived from peptides, proteins, polypeptides, and derivatives of amino acids. B) They bind to receptors on the cell surface. ... They create an enzyme cascade effect. E) They enter the cell in order to have an effect.

Last Answer : E) They enter the cell in order to have an effect.

Which of the following converts peptones, proteoses and polypeptides into amino acids : (a) Amylase (b) Trypsin (c) Lipase (d) Rennin

Description : Which of the following converts peptones, proteoses and polypeptides into amino acids : (a) Amylase (b) Trypsin (c) Lipase (d) Rennin

Last Answer : (b) Trypsin

A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Description : A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Last Answer : Answer : A

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape

The codon which serves as translation start signal is (A) AUG (B) UAG (C) UGA (D) UAA

Description : The codon which serves as translation start signal is (A) AUG (B) UAG (C) UGA (D) UAA

Last Answer : Answer : A

In the following partial sequence of mRNA, a mutation of the template DNA results in a change in codon 91 to UAA. The type of mutation is 88 89 90 91 92 93 94 GUC GAC CAG UAG GGC UAA CCG (A) Missene (B) Silent (C) Nonsense (D) Frame shit

Description : In the following partial sequence of mRNA, a mutation of the template DNA results in a change in codon 91 to UAA. The type of mutation is 88 89 90 91 92 93 94 GUC GAC CAG UAG GGC UAA CCG (A) Missene (B) Silent (C) Nonsense (D) Frame shit

Last Answer : Answer : B

Which one of the following is the starter codon? (a) UAA (b) UAG (c) AUG (d) UGA

Description : Which one of the following is the starter codon? (a) UAA (b) UAG (c) AUG (d) UGA

Last Answer : (c) AUG

Which one of the following is the starter codon? (a) UAA (b) UAG (c) AUG (d) UGA

Description : Which one of the following is the starter codon? (a) UAA (b) UAG (c) AUG (d) UGA

Last Answer : (c) AUG

Which of the termination codon is called amber? A- UAA B- UAG C- UGA D- AUG

Description : Which of the termination codon is called amber? A- UAA B- UAG C- UGA D- AUG

Last Answer : UAG

The nonsense codon(s) is/are A-UAG B-UAA C-UGA D-all of these

Description : The nonsense codon(s) is/are A-UAG B-UAA C-UGA D-all of these

Last Answer : all of these

Which of the termination codon is called amber? A- UAA B- UAG C- UGA D- AUG

Description : Which of the termination codon is called amber? A- UAA B- UAG C- UGA D- AUG

Last Answer : UAG

The nonsense codon(s) is/are A-UAG B-UAA C-UGA D-all of these

Description : The nonsense codon(s) is/are A-UAG B-UAA C-UGA D-all of these

Last Answer : all of these

Which stop codon has been found to encode selenocysteine? A- UAA B- UAG C- UGA D-.AGA

Description : Which stop codon has been found to encode selenocysteine? A- UAA B- UAG C- UGA D-.AGA

Last Answer : UGA

Out of 64 codons, 61 codons code for 20 types of amino acid. It is called (a) degeneracy of genetic code (b) overlapping of gene (c) wobbling of codon (d) universility of codons.

Description : Out of 64 codons, 61 codons code for 20 types of amino acid. It is called (a) degeneracy of genetic code (b) overlapping of gene (c) wobbling of codon (d) universility of codons.

Last Answer : (a) degeneracy of genetic code

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

Genetic code is said to be degenerate because (A) It can undergo mutations (B) A large proportion of DNA is non-coding (C) One codon can code for more than one amino acids (D) More than one codons can code for the same amino acids

Description : Genetic code is said to be degenerate because (A) It can undergo mutations (B) A large proportion of DNA is non-coding (C) One codon can code for more than one amino acids (D) More than one codons can code for the same amino acids

Last Answer : Answer : D

Degeneracy of genetic code implies that (A) Codons do not code for specific amino acid (B) Multiple codons must decode the same amino acids (C) No anticodon on tRNA molecule (D) Specific codon decodes many amino acids

Description : Degeneracy of genetic code implies that (A) Codons do not code for specific amino acid (B) Multiple codons must decode the same amino acids (C) No anticodon on tRNA molecule (D) Specific codon decodes many amino acids

Last Answer : Answer : B

Genetic code is (A) Collection of codon (B) Collection of amino acids (C) Collection of purine nucleotide (D) Collection of pyrimidine nucleotide

Description : Genetic code is (A) Collection of codon (B) Collection of amino acids (C) Collection of purine nucleotide (D) Collection of pyrimidine nucleotide

Last Answer : Answer : A

Consider the following statements: The genetic code said to be degenerate and universal which means that, (1) Amino afids may have more than one codon (2) All amino acids have mo than one codon (3) Codons are common for higher and lower organism (4) Codons are not found in bacteria

Description : Consider the following statements: The genetic code said to be degenerate and universal which means that, (1) Amino afids may have more than one codon (2) All amino acids have mo than one codon (3) Codons are common for higher and lower organism (4) Codons are not found in bacteria

Last Answer : Ans. ((d))

.Because most of the amino acids are represented by more than one codon, the genetic code is(a) overlapping (b) wobbling (c) degenerate (d) generate.

Description : .Because most of the amino acids are represented by more than one codon, the genetic code is(a) overlapping (b) wobbling (c) degenerate (d) generate.

Last Answer : a) overlapping

Because most of the amino acids are represented by more than one codon, the genetic code is(a) overlapping (b) wobbling (c) degenerate (d) generate

Description : Because most of the amino acids are represented by more than one codon, the genetic code is (a) overlapping (b) wobbling (c) degenerate (d) generate

Last Answer : (c) degenerate

5. Some amino acids are coded by more than one codon hence the codon is said to be a)Universal b)Degenerate c)Unambiguous d)Specific

Description : 5. Some amino acids are coded by more than one codon hence the codon is said to be a)Universal b)Degenerate c)Unambiguous d)Specific

Last Answer : b)Degenerate

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Description : 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Last Answer : 22

In many types of cancer, proteins that are crucial regulators of the cell cycle are often mutated and cannot function correctly. This leads to the evasion of apoptosis and to the loss of control of cell proliferation? For example, many cancer cells carry two mutant copies of the gene that codes for a tumor suppressor protein named p53. What is the normal function of p53 that is lost when it is mutated?

Description : In many types of cancer, proteins that are crucial regulators of the cell cycle are often mutated and cannot function correctly. This leads to the evasion of apoptosis and to the loss of control of cell ... protein named p53. What is the normal function of p53 that is lost when it is mutated?

Last Answer : Normally, p53 senses DNA damage and acts as a transcription factor for checkpoint control genes.

What happens if the apc gene is mutated?

Description : What happens if the apc gene is mutated?

Last Answer : Need answer

If a woman developed skin cancer as result of a mutated gene in the skin cells of her arms could she pass skin cancer gene to her children justify your answer?

Description : If a woman developed skin cancer as result of a mutated gene in the skin cells of her arms could she pass skin cancer gene to her children justify your answer?

Last Answer : Need answer

.E.coli cells with a mutated z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because (a) the lac operon is constitutively active in these cells (b) they cannot synthesise functional beta galactosidase (c) in the presence of glucose, E.coli cells do not utilise lactose (d) they cannot transport lactose from the medium into the cell.

Description : .E.coli cells with a mutated z gene of the lac operon cannot grow in medium containing only lactose as the source of energy because (a) the lac operon is constitutively active in these cells ( ... coli cells do not utilise lactose (d) they cannot transport lactose from the medium into the cell.

Last Answer : (b) they cannot synthesise functional beta galactosidase

In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Description : In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Last Answer : all above

A gene that takes part in synthesis of polypeptide is

Description : A gene that takes part in synthesis of polypeptide is

Last Answer : A gene that takes part in synthesis of polypeptide is A. Structural gene B. Regulator gene C. Operator gene D. Leading strand

The smallest unit of DNA capable of coding for the synthesis of a polypeptide is (A) Operon (B) Repressor gene (C) Cistron (D) Replicon

Description : The smallest unit of DNA capable of coding for the synthesis of a polypeptide is (A) Operon (B) Repressor gene (C) Cistron (D) Replicon

Last Answer : Answer : C

Two taps A and B are opened together to fill a tank. Both the taps fill the tank in time “x” If B separately took 25 minutes more time than “x” to fill the tank and B took 49 minutes more time than “x” to fill the tank, then find out the value of x? A) 48 minutes B) 24 minutes C) 54 minutes D) 35 minutes

Description : Two taps A and B are opened together to fill a tank. Both the taps fill the tank in time x If B separately took 25 minutes more time than x to fill the tank and B took 49 minutes more time than x ... the tank, then find out the value of x? A) 48 minutes B) 24 minutes C) 54 minutes D) 35 minutes

Last Answer : D Time is taken to fill the tank by both taps x = √a*b x = √25*49 => 5*7 => 35