A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
by

1 Answer

Answer :

Ans. ((b))
by
selected

Related questions

At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues

Description : Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues

Last Answer : Answer : A

The enzyme trypsin is specific for peptide bonds of (A) Basic amino acids (B) Acidic amino acids (C) Aromatic amino acids (D) Next to small amino acid residues

Description : The enzyme trypsin is specific for peptide bonds of (A) Basic amino acids (B) Acidic amino acids (C) Aromatic amino acids (D) Next to small amino acid residues

Last Answer : Answer : A

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

What organelles form peptide bonds between amino acids?

Description : What organelles form peptide bonds between amino acids?

Last Answer : Ribosomes. They are constructed from protein themselves, but, more germane to the question, they are also partially composed of catalytic RNA, which forges the peptide bonds.

What organelles form peptide bonds between amino acids?

Description : What organelles form peptide bonds between amino acids?

Last Answer : Ribosomes. They are constructed from protein themselves, but, more germane to the question, they are also partially composed of catalytic RNA, which forges the peptide bonds.

The only correct statement about chymotrypsin is (A) It is formed from trypsin (B) Carboxypeptidase converts trypsin into chymotrypsin (C) Its optimum pH is around 7 (D) It hydrolyses peptide bonds involving basic amino acids

Description : The only correct statement about chymotrypsin is (A) It is formed from trypsin (B) Carboxypeptidase converts trypsin into chymotrypsin (C) Its optimum pH is around 7 (D) It hydrolyses peptide bonds involving basic amino acids

Last Answer : Answer : C

Enzymes contain 1. Peptide bonds 2. Amino acids 3. Halogens 4. Fatty acids The correct answers are: (a) 1 and 4 (b) 1,3 and 4 (c) 1 and 2 (d) 2, 3 and 4

Description : Enzymes contain 1. Peptide bonds 2. Amino acids 3. Halogens 4. Fatty acids The correct answers are: (a) 1 and 4 (b) 1,3 and 4 (c) 1 and 2 (d) 2, 3 and 4

Last Answer : Ans:(c)

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Which of the following is the “quaternary structure” of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with respect to each other (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Description : Which of the following is the quaternary structure of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with ... (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Last Answer : description of the way the peptide chains are arranged with respect to each other

Each antibody molecule is made up of how many PAIR of polypeptide chains, joined together by disulfide bonds. a) 1 b) 2 c) 3 d) 4

Description : Each antibody molecule is made up of how many PAIR of polypeptide chains, joined together by disulfide bonds. a) 1 b) 2 c) 3 d) 4

Last Answer : ANSWER: B -- 2

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Last Answer : Answer : B

Edman’s reaction can be used to (A) Determine the number of tyrosine residues in a protein (B) Determine the number of aromatic amino acid residues in a protein (C) Determine the amino acid sequence of a protein (D) Hydrolyse the peptide bonds in a protein

Description : Edman’s reaction can be used to (A) Determine the number of tyrosine residues in a protein (B) Determine the number of aromatic amino acid residues in a protein (C) Determine the amino acid sequence of a protein (D) Hydrolyse the peptide bonds in a protein

Last Answer : Answer : C

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

With regard to insulin: a. it is a 51 amino acid peptide b. it is formed by removal of C-chain from proinsulin c. it is produced by the alpha cells of the pancreas d. it alters the rate of enzyme synthesis

Description : With regard to insulin: a. it is a 51 amino acid peptide b. it is formed by removal of C-chain from proinsulin c. it is produced by the alpha cells of the pancreas d. it alters the rate of enzyme synthesis

Last Answer : it alters the rate of enzyme synthesis

From two amino acids peptide bond formation involves removal of one molecule of (A) Water (B) Ammonia (C) Carbondioxide (D) Carboxylic acid

Description : From two amino acids peptide bond formation involves removal of one molecule of (A) Water (B) Ammonia (C) Carbondioxide (D) Carboxylic acid

Last Answer : Answer : A

The last step in synthesis of peptidoglycan is A- attachment of a peptide to muramic acid B- attaching two amino acids to form a cross-link C- attachment of a portion of peptidoglycan to a membrane lipid D- binding of penicillin to a membrane protein

Description : The last step in synthesis of peptidoglycan is A- attachment of a peptide to muramic acid B- attaching two amino acids to form a cross-link C- attachment of a portion of peptidoglycan to a membrane lipid D- binding of penicillin to a membrane protein

Last Answer : attaching two amino acids to form a cross-link

Consider the following statements: The genetic code said to be degenerate and universal which means that, (1) Amino afids may have more than one codon (2) All amino acids have mo than one codon (3) Codons are common for higher and lower organism (4) Codons are not found in bacteria

Description : Consider the following statements: The genetic code said to be degenerate and universal which means that, (1) Amino afids may have more than one codon (2) All amino acids have mo than one codon (3) Codons are common for higher and lower organism (4) Codons are not found in bacteria

Last Answer : Ans. ((d))

Peptide bonds are found in: a) carbohydrates b) lipids c) nucleic acids d) proteins

Description : Peptide bonds are found in: a) carbohydrates b) lipids c) nucleic acids d) proteins

Last Answer : ANSWER: D -- PROTEINS

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Nucleotide found free in the cells is: (a) CAMP (b) AMP (c) ADP (d) ATP

Description : Nucleotide found free in the cells is: (a) CAMP (b) AMP (c) ADP (d) ATP

Last Answer : Ans. ((d))

Differentiate nucleotide and nucleoside.

Description : Differentiate nucleotide and nucleoside.  

Last Answer : Ans: A nucleotide is unit of nucleic acid consisting of a nitrogen base, phosphate and a pentose sugar. A nucleoside is nucleotide without phosphate.

Genetic code is (A) Collection of codon (B) Collection of amino acids (C) Collection of purine nucleotide (D) Collection of pyrimidine nucleotide

Description : Genetic code is (A) Collection of codon (B) Collection of amino acids (C) Collection of purine nucleotide (D) Collection of pyrimidine nucleotide

Last Answer : Answer : A

In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Description : In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Last Answer : all above

What is the peptide bond that connects amino acids in proteins? -Biology

Description : What is the peptide bond that connects amino acids in proteins? -Biology

Last Answer : answer:

What is lost from amino acids in the formation of a peptide bond? -Biology

Description : What is lost from amino acids in the formation of a peptide bond? -Biology

Last Answer : answer:

What two elements are connected in a peptide bond of 2 amino acids? -Biology

Description : What two elements are connected in a peptide bond of 2 amino acids? -Biology

Last Answer : answer:

Whcih of the following hormone is a peptide of less than ten amino acids? (A) Insulin (B) Growth hormone (C) Oxytocin (D) Parathyroid hormone 228 MCQs IN BIOCHEMISTRY

Description : Whcih of the following hormone is a peptide of less than ten amino acids? (A) Insulin (B) Growth hormone (C) Oxytocin (D) Parathyroid hormone 228 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland (C) It is the precursor of ACTH and melatonin (D) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Description : All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland ... ) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

The number of amino acids in the peptide hormone calcitonin is (A) 16 (B) 24 (C) 32 (D) 40

Description : The number of amino acids in the peptide hormone calcitonin is (A) 16 (B) 24 (C) 32 (D) 40

Last Answer : Answer : C

Ninhydrin with evolution of CO2 forms a blue complex with (A) Peptide bond (B) α-Amino acids (C) Serotonin (D) Histamine

Description : Ninhydrin with evolution of CO2 forms a blue complex with (A) Peptide bond (B) α-Amino acids (C) Serotonin (D) Histamine

Last Answer : Answer : B

Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges in the protein (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Description : Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges ... (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Last Answer : reducing the disulfide bridges in the protein

Which statement is NOT true about non-steroid (peptide) hormones? A) They are derived from peptides, proteins, polypeptides, and derivatives of amino acids. B) They bind to receptors on the cell surface. C) They form cyclic AMP inside the cell. D) They create an enzyme cascade effect. E) They enter the cell in order to have an effect.

Description : Which statement is NOT true about non-steroid (peptide) hormones? A) They are derived from peptides, proteins, polypeptides, and derivatives of amino acids. B) They bind to receptors on the cell surface. ... They create an enzyme cascade effect. E) They enter the cell in order to have an effect.

Last Answer : E) They enter the cell in order to have an effect.

Fructose is a ____ that is approximately 75 percent sweeter than sucrose. a. monosaccharide c. peptide b. disaccharide d. polypeptide

Description : Fructose is a ____ that is approximately 75 percent sweeter than sucrose. a. monosaccharide c. peptide b. disaccharide d. polypeptide

Last Answer : a. monosaccharide

ATP is called a. A nucleoside b. Physiological currency c. An amino acid d. Polynucleotide

Description : ATP is called a. A nucleoside b. Physiological currency c. An amino acid d. Polynucleotide

Last Answer : b. Physiological currency

A modified amino acid solution with increased equimolar branched-chain amino acids and decreased aromatic amino acids has been proposed for patients with hepatic insufficiency. Which of the following statements is/are true? A. This formulation is proposed for the use of patients with fulminant hepatitis. B. Nitrogen balance is achieved in such patients with amounts of 40 gm. of amino acids per 24 hours. C. The use of 80 to 100 gm. of such solutions is associated with hepatic encephalopathy. D. In some studies of surgical patients, improvements in mortality have been reported.

Description : A modified amino acid solution with increased equimolar branched-chain amino acids and decreased aromatic amino acids has been proposed for patients with hepatic insufficiency. Which of the following ... D. In some studies of surgical patients, improvements in mortality have been reported.

Last Answer : Answer: D DISCUSSION: The use of modified amino acid solutions is based on the false neurotransmitter hypothesis of the cause of hepatic coma. According to this hypothesis, the imbalance ... in a group of patients with cirrhosis, decreasing morbidity and showing a trend toward decreased mortality

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis