Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Which of the following biomolecules does have a
phosphodiester bond?
(a) Amino acids in a polypeptide
(b) Nucleic acids in a nucleotide
(c) Fatty acids in a diglyceride
(d) Monosaccharides in a polysaccharide
by

1 Answer

Answer :

b) Nucleic acids in a nucleotide
by

Related questions

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

Where is the phosphodiester bond in a nucleotide? -Biology

Description : Where is the phosphodiester bond in a nucleotide? -Biology

Last Answer : answer:

In a nucleotide, the nitrogen base is joined to the sugar molecule by a) Phosphodiester bond b) Glycosidic bond c) Hydrogen bond d) (a) &(b)

Description : In a nucleotide, the nitrogen base is joined to the sugar molecule by a) Phosphodiester bond b) Glycosidic bond c) Hydrogen bond d) (a) &(b)

Last Answer : b) Glycosidic bond

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

Which one of the following biomolecules is correctly characterized? (a) Lecithin-a phosphorylated glyceride  found in cell membrane. (b) Palmitic acid - an unsaturated fatty acid with 18 carbon atoms. (c) Adenylic acid - adenosine with a glucose phosphate molecule. (d) Alanine amino acid - contains an amino group and an acidic group anywhere in the molecule.

Description : Which one of the following biomolecules is correctly characterized? (a) Lecithin-a phosphorylated glyceride  found in cell membrane. (b) Palmitic acid - an unsaturated fatty acid with 18 carbon atoms. ... Alanine amino acid - contains an amino group and an acidic group anywhere in the molecule.

Last Answer : (a) Lecithin-a phosphorylated glyceride  found in cell membrane

What are Lipids? (1) Lipids are monosaccharides (2) Lipids do not provide energy to cells (3) Fruits are a good source of lipids (4) Cholesterol and trans fatty acids are types of Lipids

Description : What are Lipids? (1) Lipids are monosaccharides (2) Lipids do not provide energy to cells (3) Fruits are a good source of lipids (4) Cholesterol and trans fatty acids are types of Lipids

Last Answer : Cholesterol and trans fatty acids are types of Lipids

Nucleotides are building blocks of nucleic acids. Each nucleotide is a composite molecule formed by `:`

Description : Nucleotides are building blocks of nucleic acids. Each nucleotide is a composite molecule formed by `:`

Last Answer : Nucleotides are building blocks of nucleic acids. Each nucleotide is a composite molecule formed by `:` ... -phosphate")_(n)` D. sugar-phosphate.

Nucleotides are building blocks of nucleic acids. Each nucleotide is a composite molecule formed by (a) base-sugar-phosphate (b) base-sugar-OH (c) (base-sugar-phosphate)n (d) sugar-phosphate.

Description : Nucleotides are building blocks of nucleic acids. Each nucleotide is a composite molecule formed by (a) base-sugar-phosphate (b) base-sugar-OH (c) (base-sugar-phosphate)n (d) sugar-phosphate.

Last Answer : (a) base-sugar-phosphate

Which one of the following structural formulae of two organic compounds is correctly identified along with its related function?(a) B : Adenine - A nucleotide that makes up nucleic acids (b) A : Triglyceride - Major source of energy (c) B : Uracil - A component of DNA (d) A : Lecithin - A component of cell membrane

Description : Which one of the following structural formulae of two organic compounds is correctly identified along with its related function? (a) B : Adenine - A nucleotide that makes up nucleic acids (b) A : Triglyceride - ... ) B : Uracil - A component of DNA (d) A : Lecithin - A component of cell membrane

Last Answer : (d) A : Lecithin - A component of cell membrane

The 3′ - 5′ phosphodiester linkages inside a polynucleotide chain serve to join (a) one DNA strand with the other DNA strand (b) one nucleoside with another nucleoside (c) one nucleotide with another nucleotide (d) one nitrogenous base with pentose sugar.

Description : The 3′ - 5′ phosphodiester linkages inside a polynucleotide chain serve to join (a) one DNA strand with the other DNA strand (b) one nucleoside with another nucleoside (c) one nucleotide with another nucleotide (d) one nitrogenous base with pentose sugar.

Last Answer : (c) one nucleotide with another nucleotide

Which is a basic unit of a sugar molecule monosaccharide amino acid fatty acid nucleotide?

Description : Which is a basic unit of a sugar molecule monosaccharide amino acid fatty acid nucleotide?

Last Answer : Monosaccharide

Structurally, glycogen is a (a) polysaccharide (b) polypeptide (c) polynucleotide (d) polyphenol

Description : Structurally, glycogen is a (a) polysaccharide (b) polypeptide (c) polynucleotide (d) polyphenol

Last Answer : Ans:(a)

Cellulose is 1. a polypeptide 2. a polysaccharide 3. a polyester 4. present in plants 5. The correct statement(s) about cellulose is/are (a) 1 only (b) 2 and 4 only (c) 1 and 4 only (d) 3 and 4 only

Description : Cellulose is 1. a polypeptide 2. a polysaccharide 3. a polyester 4. present in plants 5. The correct statement(s) about cellulose is/are (a) 1 only (b) 2 and 4 only (c) 1 and 4 only (d) 3 and 4 only

Last Answer : Ans:(b)

Amylopsin acts upon (a) polysaccharide in any medium (b) polysaccharide in acidic medium (c) polypeptide in any medium (d) Polysaccharide in alkaline medium

Description : Amylopsin acts upon (a) polysaccharide in any medium (b) polysaccharide in acidic medium (c) polypeptide in any medium (d) Polysaccharide in alkaline medium

Last Answer : (d) Polysaccharide in alkaline medium

Enzymes are (a) Carbohydrates (b) Proteins (c) Fatty acids (d) Nucleic acids

Description : Enzymes are (a) Carbohydrates (b) Proteins (c) Fatty acids (d) Nucleic acids

Last Answer : Ans:(b)

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Genetic code is (A) Collection of codon (B) Collection of amino acids (C) Collection of purine nucleotide (D) Collection of pyrimidine nucleotide

Description : Genetic code is (A) Collection of codon (B) Collection of amino acids (C) Collection of purine nucleotide (D) Collection of pyrimidine nucleotide

Last Answer : Answer : A

In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Description : In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Last Answer : all above

For biosynthesis of proteins (A) Amino acids only are required (B) Amino acids and nucleic acids only are required (C) Amino acid, nucleic acids and ATP only are required (D) Amino acids, nucleic acids, ATP, GTP, enzymes and activators are required

Description : For biosynthesis of proteins (A) Amino acids only are required (B) Amino acids and nucleic acids only are required (C) Amino acid, nucleic acids and ATP only are required (D) Amino acids, nucleic acids, ATP, GTP, enzymes and activators are required

Last Answer : Answer : D

Which of the following natural bio polymers are formed as a result of polymerisation of amino-acids? (A) Starch (B) Cellulose (C) Proteins (D) Nucleic acids

Description : Which of the following natural bio polymers are formed as a result of polymerisation of amino-acids? (A) Starch (B) Cellulose (C) Proteins (D) Nucleic acids

Last Answer : (C) Proteins

The monomeric units that make up peptides and protein polymers are __________. (a) nucleic acids (b) amino acids (c) oligosaccharides (d) amylopectins

Description : The monomeric units that make up peptides and protein polymers are __________. (a) nucleic acids (b) amino acids (c) oligosaccharides (d) amylopectins

Last Answer : amylopectins

Viroids and prions differ in that viroids are believed to contain only ______, while prions are believed to contain only _______. a. carbohydrate; amino acids b. nucleic acid; protein c. amino acids; carbohydrate d. protein; nucleic acid

Description : Viroids and prions differ in that viroids are believed to contain only ______, while prions are believed to contain only _______. a. carbohydrate; amino acids b. nucleic acid; protein c. amino acids; carbohydrate d. protein; nucleic acid

Last Answer : b. nucleic acid; protein

Which one of the following pairs is mismatched? a. Protein - amino acids b. Nucleic acid - nucleotides c. Fats - glycogen d. Starch - glucose

Description : Which one of the following pairs is mismatched? a. Protein - amino acids b. Nucleic acid - nucleotides c. Fats - glycogen d. Starch - glucose

Last Answer : c. Fats - glycogen

Nutrasweet, the artificial sweetener, contains molecules in which of the following groups? w) carbohydrates x) lipids y) amino acids z) nucleic acids

Description : Nutrasweet, the artificial sweetener, contains molecules in which of the following groups? w) carbohydrates x) lipids y) amino acids z) nucleic acids

Last Answer : ANSWER: C--AMINO ACIDS 

What is the weak bond holding the nucleic acids together in DNA? a. ionic bonds b. covalent bonds bonds c. polar bond d. hydrogen bond

Description : What is the weak bond holding the nucleic acids together in DNA? a. ionic bonds b. covalent bonds bonds c. polar bond d. hydrogen bond

Last Answer : d. hydrogen bond

What is a phosphodiester bond? -Biology

Description : What is a phosphodiester bond? -Biology

Last Answer : answer:

What is phosphodiester bond? -Biology

Description : What is phosphodiester bond? -Biology

Last Answer : answer:

Where is the phosphodiester bond in DNA? -Biology

Description : Where is the phosphodiester bond in DNA? -Biology

Last Answer : answer:

What enzyme catalyzes phosphodiester bond? -Biology

Description : What enzyme catalyzes phosphodiester bond? -Biology

Last Answer : answer:

The two polypeptides of human insulin are linked together by (a) covalent bond (b) disulphide bridges (c) hydrogen bonds (d) phosphodiester bond.

Description : The two polypeptides of human insulin are linked together by (a) covalent bond (b) disulphide bridges (c) hydrogen bonds (d) phosphodiester bond.

Last Answer : (b) disulphide bridges

The bond between sugar and nitrogenous base in case of DNA is known as (a) Gycosidic bond (b) Phosphodiester bond (c) H-bond (d) Peptide bond

Description : The bond between sugar and nitrogenous base in case of DNA is known as (a) Gycosidic bond (b) Phosphodiester bond (c) H-bond (d) Peptide bond

Last Answer : (a) Gycosidic bond

9.The reason behind the anti-parallel strand of DNA is 1. Hydrogen bond 2. Ionic bond 3. Phosphodiester bond 4. Disulphide bond

Description : 9.The reason behind the anti-parallel strand of DNA is 1. Hydrogen bond 2. Ionic bond 3. Phosphodiester bond 4. Disulphide bond

Last Answer : Ans: Phosphodiester bond.

What is the difference between a nucleotide and a nucleic acid?

Description : What is the difference between a nucleotide and a nucleic acid?

Last Answer : A: A nucleotide is a building block of nucleic acids, consisting of a sugar, a phosphate group, and a nitrogenous base, while a nucleic acid is a polymer made up of nucleotide monomers.

ATP is (a) nucleotide (b) nucleoside (c) nucleic acid (d) vitamin.

Description : ATP is (a) nucleotide (b) nucleoside (c) nucleic acid (d) vitamin.

Last Answer : (a) nucleotide

The basic unit of nucleic acid is (a) pentose sugar (b) nucleoid (c) nucleoside (d) nucleotide.

Description : The basic unit of nucleic acid is (a) pentose sugar (b) nucleoid (c) nucleoside (d) nucleotide.

Last Answer : d) nucleotide.

The bacteria which cause dental cavities in humans break down sugars, releasing what chemical, that causes tooth destruction? a) acids b) bases c) enzymes d) monosaccharides

Description : The bacteria which cause dental cavities in humans break down sugars, releasing what chemical, that causes tooth destruction? a) acids b) bases c) enzymes d) monosaccharides

Last Answer : ANSWER: A -- acids

Calcium absorption is inferred by (A) Fatty acids (B) Amino acids (C) Vitamin D (D) Vitamin B12

Description : Calcium absorption is inferred by (A) Fatty acids (B) Amino acids (C) Vitamin D (D) Vitamin B12

Last Answer : Answer : A

Thiamin diphosphate is required for oxidative decarboxylation of (A) α-Keto acids (B) α-Amino acids (C) Fatty acids (D) All of these

Description : Thiamin diphosphate is required for oxidative decarboxylation of (A) α-Keto acids (B) α-Amino acids (C) Fatty acids (D) All of these

Last Answer : Answer : A

Phrynoderma is a deficiency of (A) Essential fatty acids(B) Proteins (C) Amino acids (D) None of these

Description : Phrynoderma is a deficiency of (A) Essential fatty acids(B) Proteins (C) Amino acids (D) None of these

Last Answer : Answer : A