ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

1 Answer

Answer :

Answer :  A

Related questions

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

Description : All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland ... ) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY

Last Answer : Answer : C

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

Description : Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84

Last Answer : Answer : A

Description : The number of amino acid residues in PTH: (A) 51 (B) 84 (C) 90 (D) 115

Last Answer : Answer : B

Description : Number of amino acid residues in prolactin is (A) 51 (B) 84 (C) 191 (D) 198

Last Answer : Answer : D

Description : Number of amino acid residues in human growth hormone is (A) 51 (B) 84 (C) 191 (D) 198

Last Answer : Answer : C

Description : The number of amino acid residues in preproinsulin is (A) 51 (B) 84 (C) 109 (D) 119

Last Answer : Answer : C

Description : The number of amino acid residues in calcitonin in (A) 9 (B) 32 (C) 51 (D) 84

Last Answer : Answer : B

Description : Hormonal activity of ACTH is completely lost on removal of (A) 5 C-terminal amino acids (B) 10 C-terminal amino acids (C) 15 C-terminal amino acids (D) None of these

Last Answer : Answer : D

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

Description : The number of amino acids in parathormone is (A) 65 (B) 84 (C) 115 (D) 122

Last Answer : Answer : B

Description : The number of amino acids in pre-pro insulin is (A) 51 (B) 86 (C) 109 (D) 132

Last Answer : Answer : C

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Description : Each gm of protein on complete oxidation yields (A) 0.21 gm water (B) 0.31 gm water (C) 0.41 gm water (D) 0.51 gm water

Last Answer : Answer : C

Description : Biological activity of ACTH requires (A) 10-N-terminal amino acid (B) 24-N-terminal amino acid (C) 24-C-terminal amino acid (D) 15-C-terminal amino acid

Last Answer : Answer : B

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

Description : During which decade did the population record a negative growth rate? (a) 1921-31 (b) 1911-21 (c) 1941-51 (d) 1931-41

Last Answer : Ans: (b)

Description : During which decade did the population of India record a negative growth rate? (1) 1921-31 (2) 1911-21 (3) 1941-51 (4) 1931-41

Last Answer : (2) 1911-21 Explanation: Negative Population growth rate or decline in population can refer to the decline in population of humans. It is a term usually used to describe any great reduction in a ... famines accounted for this decline. Plague epidemic in 1918 took a toll of 140 lakh human lives.

Description : The holder (an adult and not a minor) of a certificate who desire to make a  nomination will apply in a) NC 36 b) NC 51 c) NC 10 d) NC 41

Last Answer : b) NC 51

Description : The holder (an adult and not a minor) of a certificate who desire to make a  nomination will apply in a) NC 36 b) NC 51 c) NC 10 d) NC 41

Last Answer : b) NC 51

Description : An asset of Rs.85,000 was purchased for Rs.75,000 and was recorded in the books at Rs.85,000. What is the correct amount of profit to be reported in the books? a) Rs.1,47,000 b) Rs. 1,51,000 c) Rs.1,63,000 d) Rs.1,41,000

Last Answer : b) Rs. 1,51,000

Description : The minimum and maximum clearances of check rails at all BG level crossings shall be a) 51 to 57 mm* b) 44 to 48 mm c) 41 to 45 mm d) 55 to 70 mm

Last Answer : a) 51 to 57 mm*

Description : Nesha scored 120 out of 150 in English, 120 out of 180 in mathematics and 160 out of 200 in Science. Find Nesha’s score as percentage: (i) in Mathematics (ii) in all the three subjects (on the whole). a) 66 2/3, 78 22/51 b) 71 23/5, 45 7/31 c) 54 13/33, 82 3/4 d) 60 3/4, 76 32/41 

Last Answer :  Answer: A (i) Percentage scored in Mathematics = 120/180 100  = 12000/180  =1200/18  = 66 2 /3 % (ii) Total maximum of all the three subjects = 150 + 160 + 200 = 510 and Total score in the ... percentage on the whole = (400/510 100)  = (40000/510)  = 4000/51  = 78 22/51 %

Description : 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Last Answer : 22

Description : Maria, Ivan, Leah, Julie, and Scott measured each other’s heights for health class The heights are 42 39 41, 37 and 39 inches Julie is 2 inches shorter than Leah Maria is 1 inch shorter than Scott and 2 inches taller than Leah How tall is each student?

Last Answer : it is 5th grade math

Description : Three telephone circuits, each having an S/N ratio of 44 dB, are connected in tandem. What is the overall S/N ratio? A. 44 dB B. 39.2 dB C. 41 dB D. 43.52 dB

Last Answer : B. 39.2 dB

Description : The staff reading at a distance of 80 m from a level with the bubble at its centre is 1.31 m. When the bubble is moved by 5 divisions out of the centre, the reading is 1.39 m. The angular value of the one division of the bubble, is (A) 28.8 sec (B) 41.25 sec (C) 14.52 sec (D) 25.05

Last Answer : (B) 41.25 sec

Description : Ravi borrowed some money at the rate of 4 p.c.p.a. for the first three years, at the rate of 8 p.c.p.a. for the next two years and at the rate of 9 p.c.p.a. for the period beyond 5 years. If he pays a ... 7 years, how much money did he borrow? a) 39,500 b) 42,500 c) 41,900 d) 43,000 e) None of these

Last Answer : Let the amount borrowed be Rs P Total amount of simple interest = (P×3×4)/100 + (p×2×8)/100 + (p×2×9)/100 = 19550 0.12P + 0.16P + 0.18P = 19550 0.46p= 19550 P = Rs. 42500 Answer: b)

Description : At what height must top rails be fitted above working platform? a. Between 90 cm (35 inches) and 110 cm (43 inches) b. Between 100 cm (39 inches) and 120 cm (47 inches) c. Between 95 cm (38 inches) and 115 cm ( 45 inches) d. Between 105 cm (41 inches)and 125 cm (49 inches)

Last Answer : c. Between 95 cm (38 inches) and 115 cm ( 45 inches)

Description : The sequence of amino acid in which the biological value of parathormone is (A) 1–15 (B) 1–34 (C) 30–50 (D) 50–84

Last Answer : Answer : B

Description : The median of the data 78, 56, 22, 34, 45, 54, 39, 68, 54 and 84 is -Maths 9th

Last Answer : NEED ANSWER

Description : The median of the data 78, 56, 22, 34, 45, 54, 39, 68, 54 and 84 is -Maths 9th

Last Answer : According to question find the median of the data

Description : At 60° C, vapour pressure of methanol and water are 84.562 kPa and 19.953 kPa respectively. An aqueous solution of methanol at 60° C exerts a pressure of 39.223 kPa; the liquid phase and vapour phase mole ... respectively. Activity co-efficient of methanol is (A) 1.572 (B) 1.9398 (C) 3.389

Last Answer : (A) 1.572

Description : What is 35.78 plus 39.51?

Last Answer : 75.29 - 39.51 = 35.78