Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin
Last Answer : Answer : C
Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids
Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Last Answer : Answer : B
Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Last Answer : Answer : A
Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction
Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
Last Answer : Ans. ((b))
Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.
Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.
Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.
Last Answer : (a) A polypeptide of 24 amino acids will be formed.
Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide
Last Answer : b) Nucleic acids in a nucleotide
Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four
Last Answer : Three
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains
Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine
Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY
Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine
Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine
Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid
Last Answer : Answer : D
Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix
Last Answer : the amino acid sequence in the polypeptide chain
Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis
Last Answer : adaptor hypothesis
Description : Why are two samples of proteins having an identical composition of amino acids still different?
Last Answer : I would guess that two proteins with the same sequences of amino acids might be folded in different ways giving them different properties.
Description : How do amino acids form themselves into proteins?
Last Answer : answer:Here is a link that explains a few things. one of the things it states is: To form protein, the amino acids are linked by dehydration synthesis to form peptide bonds. The chain of ... they conduct and experiment where amino acids and proteins are created by mixing gases. I hope it helps.
Description : The xylem in plants are responsible for (i) transport of water (ii) transport of food (iii) transport of amino acids (iv) transport of oxygen -Biology
Last Answer : The xylem in the plants is responsible for - i) transport of water. The Xylem vessel is a transport tissue present in vascular plants. The main function of xylem is to transport water from the roots to the shoots and leaves, but it also transports nutrient from one place to another.
Description : Name the amino acids in which sulphur is present. -Biology
Last Answer : answer:
Description : What are the essential and non-essential amino acids? -Biology
Description : What is the peptide bond that connects amino acids in proteins? -Biology
Description : What is lost from amino acids in the formation of a peptide bond? -Biology
Description : What two elements are connected in a peptide bond of 2 amino acids? -Biology
Description : Write a note on amino acids. -Biology
Description : What are non-essential amino acids? -Biology
Description : What bond links amino acids together? -Biology
Description : Which characteristic makes nine amino acids “essential”?
Last Answer : the body cannot make them
Description : The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?
Last Answer : beads of different colors joined together on a piece of string
Description : how many amino acids are there in one turn of alpha helix?
Last Answer : 3.6 amino acid.
Description : What are amino acids ?
Last Answer : Amino acids are the monomers of proteins. It is an organic compound that contains both amino radicals ( -NH2) and carboxyl radicals (-COOH ) .
Description : How many of the 20 amino acids are called essential amino acids ?
Last Answer : Out of 20 amino acids, 6 acids are called essential amino acids.
Description : How many types of amino acids have been found in the human body so far ?
Last Answer : So far 20 amino acids have been found in human body.
Last Answer : : The amino acid urea is converted into liver.
Description : how does carbon, hydrogen, and oxygen from sugar combine with other elements to make amino acids
Last Answer : I would suggest that you read your text book as this is not a question that can be answered in a line or 2 or you can read here: http://www.chemistryland.com/ElementarySchool/BuildingBlocks/BuildingOrganic.htm
Description : Experiences with parenteral amino acids?
Last Answer : The experience with Paternal amino acids results where as a done reaction. As it took about 4 weeks to become a change to yellow, of the substance used. Because of less of the Paternal amino acid the higher chances for proteins, and salts.
Description : Which one of the following amino acids is not found in proteins ?
Last Answer : Which one of the following amino acids is not found in proteins ? A. Arginine B. Ornithine C. Aspartic acid D. Tyrosine
Description : Amino acids are absorbed in -
Last Answer : Amino acids are absorbed in - A. Blood capillaries of villi B. Wall of rectum C. lacteals and blood capillaries of villi D. lacteals of villi
Description : Proteins are broken down into amino acids in -
Last Answer : Proteins are broken down into amino acids in - A. Buccal cavity B. Stomach C. Intestine D. Rectum
Description : The major site of protein breakdown to form free amino acids, is the
Last Answer : The major site of protein breakdown to form free amino acids, is the A. Kidney B. Spleen C. Liver D. Bone-marrow
Description : Match the codons given in column I with their respective amino acids given in column II and choose the correct answer.
Last Answer : Match the codons given in column I with their respective amino acids given in column II and choose the correct answer. ... -II, b-IV, c-I, d-V, e-III
Description : Energy for activation of amino acids during proteins synthesis comes from
Last Answer : Energy for activation of amino acids during proteins synthesis comes from A. ATP B. GTP C. CTP D. UTP
Description : Granis of major cereals and millets lack amino acids
Last Answer : Granis of major cereals and millets lack amino acids A. Methionine and cysteine B. Methionine ... . Tryoptophan and cysteine D. Lysine and troptophan
Description : Glucose, amino acids and `Na^(+)` are reaborbed____
Last Answer : Glucose, amino acids and `Na^(+)` are reaborbed____