Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
Last Answer : Answer : B
Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
Last Answer : Answer : C
Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY
Description : Match the source gland with its respective hormone and function and select the correct option. Source Hormone Function gland (a) Anterior Oxytocin Contraction of uterus pituitary muscles during ... (c) Corpus Estrogen Supports pregnancy luteum (d) Thyroid Thyroxine Regulates blood calcium level
Last Answer : (b) Posterior Vasopressin Stimulates pituitary reabsorption of water in the distal tubules in the nephron
Description : Which one of the following hormone is called ”Emergency Hormone” ? (1) Adrenaline (2) Thyroxine (3) Vasopressin (4) Insulin
Last Answer : Adrenaline
Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
Last Answer : Ans. ((b))
Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four
Last Answer : Three
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : The number of amino acids in the peptide hormone calcitonin is (A) 16 (B) 24 (C) 32 (D) 40
Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond
Description : The harmone acting directly on intestinal mucosa and stimulating glucose absorption is (A) Insulin (B) Glucagon (C) Thyroxine (D) Vasopressin
Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine
Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids
Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Last Answer : Answer : A
Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction
Description : The desaturation and chain elongation system of polyunsaturated fatty acids are greatly diminished in the absence of (A) Insulin (B) Glycagon (C) Epinephrine (D) Thyroxine
Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain
Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix
Last Answer : the amino acid sequence in the polypeptide chain
Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.
Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150
Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.
Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.
Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.
Last Answer : (a) A polypeptide of 24 amino acids will be formed.
Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide
Last Answer : b) Nucleic acids in a nucleotide
Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : Which of the following hormones is not involved in carbohydrate metabolism? (A) ACTH (B) Glucagon (C) Vasopressin (D) Growth hormone
Description : Vasopressin is also known as (A) Antidiabetogenic hormone (B) Antidiuretic hormone (C) Somatotropic hormone (D) Pitoxin
Description : Which of the following hormones are synthesized as prehormones (A) Vasopressin and oxytocin (B) Growth hormone and insulin (C) Insulin and parathyroid hormone (D) Insulin and Glucagon
Description : A hormone synthesised in the hypothalamus is (A) Melatonin (B) Melanocyte stimulating hormone (C) Vasopressin (D) Prolactin
Description : Increased reabsorption of water from the kidney is the major consequence of the secretion of the hormone? (A) Cortisol (B) Insulin (C) Vasopressin (D) Aldosterone
Description : The hormone required for uterine muscle contraction for child birth is (A) Progesterone (B) Estrogen (C) Oxytocin (D) Vasopressin
Description : A hormone secreted from posterior pituitary is (A) Vasopressin (B) Thyrotropic hormone (C) Prolactin (D) Adrenocorticotropic hormone CHAPTER 8 CHAPTER 8 HORMONE METABOLISM ABOLISM
Description : A hormone secreted from anterior pituitary is (A) Growth hormone (B) Vasopressin (C) Oxytocin (D) Epinephrine
Description : The catalytic power of enzymes is due to (a) the presence of amino acids in their structures (b) their high molecular weight (c) their ability to lower the activation energy of the reaction (d) their limited solubility in water and other solvents
Last Answer : Ans:(c)
Description : The sequence of amino acids in human growth hormone and the synthesis were done by (A) Sanger (B) Krebs (C) Chah Holi (D) Molisch
Description : Whcih of the following hormone is a peptide of less than ten amino acids? (A) Insulin (B) Growth hormone (C) Oxytocin (D) Parathyroid hormone 228 MCQs IN BIOCHEMISTRY
Description : Thyroid stimulating hormone is a dimer. The α-subunits of TSH, LH, FSH are identical. Thus the biological specificity must therefore be β subunit in which the number of amino acids is (A) 78 (B) 112 (C) 130 (D) 199
Description : The number of amino acids in antidiuretic hormone is (A) 9 (B) 18 (C) 27 (D) 36
Description : The number of amino acids in the hormone oxytocin is (A) 7 (B) 9 (C) 14 (D) 18
Description : The number of amino acids in human growth hormone is (A) 91 (B) 151 (C) 191 (D) 291
Description : All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons
Description : Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38
Description : The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain
Description : Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain
Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine
Last Answer : Answer : D
Description : The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids
Description : All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine
Description : What are branched chain amino acids?
Last Answer : Valine, leucine and isoleucine.
Description : This pancreatic hormone increases the blood-sugar level: (A) Insulin (B) Glucagon (C) Pancreozymin (D) Pancreatic polypeptide