The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
by

1 Answer

Answer :

Answer :  B
by
selected

Related questions

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38

Description : Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38

Last Answer : Answer : B

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

Sufficient energy required to produce 3 ATP from 3 ADP and 3 pi is (A) –21,900 cal (B) 29,900 cal (C) 31,900 cal (D) 39,900 cal

Description : Sufficient energy required to produce 3 ATP from 3 ADP and 3 pi is (A) –21,900 cal (B) 29,900 cal (C) 31,900 cal (D) 39,900 cal

Last Answer : A

Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84

Description : Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84

Last Answer : Answer : A

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Description : 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50'. What number is missing? -Riddles

Last Answer : 22

In a Examination a candidate has to score minimum of 24 marks inorder to clear the exam. The maximum that he can score is 40 marks. Identify the Valid Equivalance values if the student clears the exam. A. 22,23,26 B. 21,39,40 C. 29,30,31 D. 0,15,22

Description : In a Examination a candidate has to score minimum of 24 marks inorder to clear the exam. The maximum that he can score is 40 marks. Identify the Valid Equivalance values if the student clears the exam. A. 22,23,26 B. 21,39,40 C. 29,30,31 D. 0,15,22

Last Answer : C. 29,30,31

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

On selling 25 balls at Rs. 1015, there is a profit equal to the cost price of 10 balls. What is the cost price of a ball? a) Rs. 31 b) Rs. 29 c) Rs. 35 d) Rs. 27 e) Rs. 39

Description : On selling 25 balls at Rs. 1015, there is a profit equal to the cost price of 10 balls. What is the cost price of a ball? a) Rs. 31 b) Rs. 29 c) Rs. 35 d) Rs. 27 e) Rs. 39

Last Answer : b Profit = (S.P of 25 balls) - (C.P of 25 balls) = 1015 - (C.P of 25 balls) Given that Profit = (C.P of 10 balls) => 1015 - (C.P of 25 balls) = (C.P of 10 balls) => (C.P of 25 balls) + (C.P of 10 balls) = 1015 => C.P of 35 balls = 1015 => C.P of 1 ball=1015 / 35 = Rs. 29

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

In India, according to the 2001 Census, the female literacy rate is – (1) 39.29 (2) 54.16 (3) 21.97 (4) 29.76

Description : In India, according to the 2001 Census, the female literacy rate is – (1) 39.29 (2) 54.16 (3) 21.97 (4) 29.76

Last Answer : (2) 54.16 Explanation: From comparison to the 1991 census, the male literacy rate increased to 75.26%, which showed an increase of 11.13%.0n the other hand, the female literacy of 53.67% increased at a much faster rate of 14.38%. According to 2011 census, female literacy rate of India is 64.6%.

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

Explain function of following pins of 8051 (i) Pin 31 (ii) Pin 29 (iii) Pin 21-28

Description : Explain function of following pins of 8051 (i) Pin 31 (ii) Pin 29 (iii) Pin 21-28 

Last Answer : i) Pin 31-EA : It is and active low I/P to 8051 microcontroller. When (EA)= 0, then 8051 microcontroller access from external program memory (ROM) only. When (EA) = 1, then it access internal ... /Output, when external memory is interfaced, PORT 2 pins act as the higher-order address bus. (A8-A15)

All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons

Description : All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons

Last Answer : Answer : C

The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the human has an impaired ability to synthesize the carbon chain of the corresponding ketoacids (C) are identical in all species studied (D) are defined as these amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Description : The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Last Answer : Answer : B

Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain

Description : Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain

Last Answer : Answer : B

Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain

Description : Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain

Last Answer : Answer : B

Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine

Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine

Last Answer : Answer : D

The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the human has an impaired ability to synthesize the carbon chain of the corresponding ketoacids (C) Are identical in all species studied (D) Are defined as those amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Description : The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Last Answer : Answer : B

Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids

Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids

Last Answer : Answer : C

All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine

Description : All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine

Last Answer : Answer : B

What are branched chain amino acids?

Description : What are branched chain amino acids?

Last Answer : Valine, leucine and isoleucine.

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Last Answer : Answer : A

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Last Answer : Answer : B

At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Description : Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Last Answer : Answer : A

In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Description : In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Last Answer : Hydroxyl group of serine or threonine.

The maineffecting of glucagons is to increase (A) Glycolysis in muscles (B) Glycogenolysis in muscles (C) Glycogenolysis in liver (D) Glycogenesis in liver

Description : The maineffecting of glucagons is to increase (A) Glycolysis in muscles (B) Glycogenolysis in muscles (C) Glycogenolysis in liver (D) Glycogenesis in liver

Last Answer : Answer : C

Second messenger for glucagons is (A) Cyclic AMP (B) Diacylglycerol (C) Cyclic GMP (D) Inositol triphosphate

Description : Second messenger for glucagons is (A) Cyclic AMP (B) Diacylglycerol (C) Cyclic GMP (D) Inositol triphosphate

Last Answer : Answer : A

Signal transducer for glucagons is a (A) Cyclic nucleotide (B) Phosphoinositide (C) Stimulatory G-protein (D) Inhibitory G-protein

Description : Signal transducer for glucagons is a (A) Cyclic nucleotide (B) Phosphoinositide (C) Stimulatory G-protein (D) Inhibitory G-protein

Last Answer : Answer : C

Normal serum glucagons level in fasting state varies between (A) 0-–10 pg/ml (B) 20–100 pg/ml (C) 200–300 pg/ml (D) 400–500 pg/ml

Description : Normal serum glucagons level in fasting state varies between (A) 0-–10 pg/ml (B) 20–100 pg/ml (C) 200–300 pg/ml (D) 400–500 pg/ml

Last Answer : Answer : B

The half life of glucagons is (A) ~5 (B) ~7 (C) ~10 (D) ~12

Description : The half life of glucagons is (A) ~5 (B) ~7 (C) ~10 (D) ~12

Last Answer : Answer : A

The rate of HMP shunt reactions is (A) Increased by Insulin (B) Increased in diabetes mellitus (C) Increased by glucagons (D) Increased in starvation

Description : The rate of HMP shunt reactions is (A) Increased by Insulin (B) Increased in diabetes mellitus (C) Increased by glucagons (D) Increased in starvation

Last Answer : Answer : A