Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four heme groups. As a protein composed of association of polypeptide chains, the functionality of hemoglobin depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule

Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four heme groups. As a protein composed of association of polypeptide chains, the functionality of hemoglobin depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule
by

1 Answer

Answer :

On average what is the life duration of the red blood cells?
by
selected by

Related questions

The following protein/polypeptide has a quaternary structure : (A) cc-Chymotrypsin (B) Hemoglobin (C) Insulin (D) Myoglobin

Description : The following protein/polypeptide has a quaternary structure : (A) cc-Chymotrypsin (B) Hemoglobin (C) Insulin (D) Myoglobin

Last Answer : (B) Hemoglobin

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

Which of the following is the “quaternary structure” of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with respect to each other (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Description : Which of the following is the quaternary structure of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with ... (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Last Answer : description of the way the peptide chains are arranged with respect to each other

Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Description : Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Last Answer : Answer : A

Each antibody molecule is made up of how many PAIR of polypeptide chains, joined together by disulfide bonds. a) 1 b) 2 c) 3 d) 4

Description : Each antibody molecule is made up of how many PAIR of polypeptide chains, joined together by disulfide bonds. a) 1 b) 2 c) 3 d) 4

Last Answer : ANSWER: B -- 2

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

The number of polypeptide chains present in a molecule of haemoglobin is/are

Description : The number of polypeptide chains present in a molecule of haemoglobin is/are

Last Answer : The number of polypeptide chains present in a molecule of haemoglobin is/are A. 1 B. 3 C. 4 D. 2

Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide chains. Reason `:` Haemoglobin is a conjugate protein an

Description : Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide chains. Reason `:` Haemoglobin is a conjugate protein an

Last Answer : Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide ... False. D. If both Assertion & Reason are false.

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

Bile, an emulsifier liquid, is made by the liver and later stored within the gallbladder and released in the duodenum. Bile is composed of bile salts, cholesterol and bile pigments. Bile salts are detergents, amphiphilic molecules, i.e., molecules with a polar water-soluble portion and a non-polar fat-soluble portion. This feature allows bile salts to enclose fats inside water-soluble micelles in a process called emulsification for them to be in contact with intestinal lipases, enzymes that break fats into simpler fatty acids and glycerol. Digestion System - Image Diversity: gallbladder

Description : Bile, an emulsifier liquid, is made by the liver and later stored within the gallbladder and released in the duodenum. Bile is composed of bile salts, cholesterol and bile pigments. ... enzymes that break fats into simpler fatty acids and glycerol. Digestion System - Image Diversity: gallbladder

Last Answer : What is the adnexal organ of the digestive system in which bile is stored?

On average red blood cells live around 120 days. The spleen is the main organ where old red blood cells are destroyed. During the red blood cell destruction the heme groups turn into bilirubin and this substance is then captured by the liver and later excreted in the bowels as part of the bile.

Description : On average red blood cells live around 120 days. The spleen is the main organ where old red blood cells are destroyed. During the red blood cell destruction the heme groups turn into bilirubin and this substance is then captured by the liver and later excreted in the bowels as part of the bile.

Last Answer : What are the functions of the spleen?

In biotin-containing enzymes, the biotin is bound to the enzyme by (A) An amide linkage to carboxyl group of glutamine (B) A covalent bond with CO2 (C) An amide linkage to an amino group of lysine (D) An amide linkage to α-carboxyl group of protein

Description : In biotin-containing enzymes, the biotin is bound to the enzyme by (A) An amide linkage to carboxyl group of glutamine (B) A covalent bond with CO2 (C) An amide linkage to an amino group of lysine (D) An amide linkage to α-carboxyl group of protein

Last Answer : Answer : C

The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Description : The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Last Answer : Answer : B

Prosthetic groups differ from co-enzymes in that (a) they require metal ions for their activity (b) they (prosthetic groups) are tightly bound to apoenzymes (c) their association with apoenzymes is transient (d) they can serve as co-factors in a number of enzyme-catalyzed reactions.

Description : Prosthetic groups differ from co-enzymes in that (a) they require metal ions for their activity (b) they (prosthetic groups) are tightly bound to apoenzymes (c) their association with apoenzymes is transient (d) they can serve as co-factors in a number of enzyme-catalyzed reactions.

Last Answer : (b) they (prosthetic groups) are tightly bound to apoenzymes

This fundamental ethical principle prohibits association of professional accountants with reports, returns, communications and other information that contains materially false or misleading information or statements. a. Integrity b. Objectivity c. Professional competence and due care d. Professional behavior

Description : This fundamental ethical principle prohibits association of professional accountants with reports, returns, communications and other information that contains materially false or misleading information or statements ... b. Objectivity c. Professional competence and due care d. Professional behavior

Last Answer : Integrity

The digestive system, also known as “systema digestorium”, or gastrointestinal system, is composed of the digestive tube organs plus the digestive adnexal glands. The digestive tube is composed of mouth, pharynx, esophagus, stomach, small intestine (duodenum, jejunum, ileum), large intestine (caecum, colon, rectum) and anus. Digestion System - Image Diversity: human digestive system

Description : The digestive system, also known as systema digestorium , or gastrointestinal system, is composed of the digestive tube organs plus the digestive adnexal glands. The digestive tube is composed of mouth ... (caecum, colon, rectum) and anus. Digestion System - Image Diversity: human digestive system

Last Answer : What are peristaltic movements? What is their role in human digestion?

The following are true about the sodium channels: a. they are made up of polypeptide chains b. have the highest densities at the nodes of Ranvier c. open in response to depolarization d. remain open as long as depolarization is maintained

Description : The following are true about the sodium channels: a. they are made up of polypeptide chains b. have the highest densities at the nodes of Ranvier c. open in response to depolarization d. remain open as long as depolarization is maintained

Last Answer : have the highest densities at the nodes of Ranvier

Denaturation refers to the loss of the ______ structure of a ______ molecule. a. primary; carbohydrate b. molecular; fat c. secondary; starch d. tertiary; protein

Description : Denaturation refers to the loss of the ______ structure of a ______ molecule. a. primary; carbohydrate b. molecular; fat c. secondary; starch d. tertiary; protein

Last Answer : d. tertiary; protein

What bonds hold together the Quaternary structure of protein? -Biology

Description : What bonds hold together the Quaternary structure of protein? -Biology

Last Answer : answer:

In protein structure the α-helix and βpleated sheets are example of (A) Primary structure (B) Secondary structure (C) Tertiary structure (D) Quaternary structure

Description : In protein structure the α-helix and βpleated sheets are example of (A) Primary structure (B) Secondary structure (C) Tertiary structure (D) Quaternary structure

Last Answer : Answer : B

The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Description : The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Last Answer : a. primary

Antigens and haptens have the following similarity: (A) They have high molecular weights (B) They can elicit immune response by themselves (C) They can elicit an immune response only in association with some other large molecule (D) Once an immune response develops, free antigen and free hapten can be recognized by the antibody

Description : Antigens and haptens have the following similarity: (A) They have high molecular weights (B) They can elicit immune response by themselves (C) They can elicit an immune response only in association ... ) Once an immune response develops, free antigen and free hapten can be recognized by the antibody

Last Answer : Answer : D

Hemoglobin in the blood is a complex protein rich in A. Copper B. Iron C. Silver D. Gold

Description : Hemoglobin in the blood is a complex protein rich in A. Copper B. Iron C. Silver D. Gold

Last Answer : ANSWER: B

Thyroperoxidase enzyme contains (A) Heme (B) Copper (C) Zinc (D) Magnesium

Description : Thyroperoxidase enzyme contains (A) Heme (B) Copper (C) Zinc (D) Magnesium

Last Answer : Answer : A

Numerous antibodies can be prepared, against one antigen, each binds to unique epitopes. How is this antibody diversity generated? A- By rearrangements of the DNA encoding the variable regions of the heavy and light chains B- By the combination of different heavy and light chains that form the antigen binding siteC- Antibody proteins can physically change their shape to bind different epitopes D- Both (a) and (b)

Description : Numerous antibodies can be prepared, against one antigen, each binds to unique epitopes. How is this antibody diversity generated? A- By rearrangements of the DNA encoding the variable regions of the heavy ... proteins can physically change their shape to bind different epitopes D- Both (a) and (b)

Last Answer : Both (a) and (b)

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Last Answer : Answer : B

When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Description : When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Last Answer : Answer : C

Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Description : Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Last Answer : Answer : B

An immunoglobulin molecule always contains (A) 1 κ and 3 λ type of chains (B) 2 κ and 2 λ type of chains (C) 3 κ and 1λ type of chains (D) 2 κ and 2 λ chains

Description : An immunoglobulin molecule always contains (A) 1 κ and 3 λ type of chains (B) 2 κ and 2 λ type of chains (C) 3 κ and 1λ type of chains (D) 2 κ and 2 λ chains

Last Answer : Answer : D

What is the difference between heme and non heme iron?

Description : What is the difference between heme and non heme iron?

Last Answer : answer:Here's an article from NIH that discusses absorption of heme vs. non-heme iron: Absorption of heme iron ranges from 15% to 35%, and is not significantly affected by diet [15]. In contrast, ... phytates (found in legumes and whole grains) can decrease absorption of nonheme iron [1,19-24]...

Each myoglobin molecule contains (A) One iron atom (B) Two iron atoms (C) Four iron atoms (D) Six iron atoms

Description : Each myoglobin molecule contains (A) One iron atom (B) Two iron atoms (C) Four iron atoms (D) Six iron atoms

Last Answer : Answer : A

Each haemoglobin molecule contains (A) One iron atom (B) Two iron atoms (C) Four iron atoms (D) Six iron atoms

Description : Each haemoglobin molecule contains (A) One iron atom (B) Two iron atoms (C) Four iron atoms (D) Six iron atoms

Last Answer : Answer : C

Protein present in hemoglobin has the structure known as (A) Primary (B) Secondary (C) Tertiary (D) Quarternary

Description : Protein present in hemoglobin has the structure known as (A) Primary (B) Secondary (C) Tertiary (D) Quarternary

Last Answer : Answer : D

Assuming roughly equivalent molecular weights, which of the following would have the highest boiling point? (a) a tertiary amine (b) a quaternary ammonium salt (c) an alcohol (d) an ether

Description : Assuming roughly equivalent molecular weights, which of the following would have the highest boiling point? (a) a tertiary amine (b) a quaternary ammonium salt (c) an alcohol (d) an ether

Last Answer : a quaternary ammonium salt

The half-life of a protein depends upon its (A) Signal sequence (B) N-terminus amino acid (C) C-terminus amino acid (D) Prosthetic group

Description : The half-life of a protein depends upon its (A) Signal sequence (B) N-terminus amino acid (C) C-terminus amino acid (D) Prosthetic group

Last Answer : Answer : B

The success of democracy depends upon the – (1) Right to criticise (2) Right to association (3) Right to personal liberty (4) Right to property

Description : The success of democracy depends upon the – (1) Right to criticise (2) Right to association (3) Right to personal liberty (4) Right to property

Last Answer : (3) Right to personal liberty Explanation: The Constitution guarantees that one has a right to liberty and freedom, except in accordance with the law. This means that, in general, one ... detention in certain circumstances. Right to personal liberty is considered one of the foundations of democracy.

The success of democracy depends upon the – (1) Right to criticise (2) Right to association (3) Right to personal liberty (4) Right to property

Description : The success of democracy depends upon the – (1) Right to criticise (2) Right to association (3) Right to personal liberty (4) Right to property

Last Answer : (3) Right to personal liberty Explanation: Right to personal liberty is the bedrock of any democratic set up. In India, the right to life and personal liberty is available to all people and so ... . Time and again, the Supreme Court has reiterated that the word liberty is a very comprehensive word.

Which one of the following metals is essential to the structure and functioning of hemoglobin? w) copper x) magnesium y) tin z) iron

Description : Which one of the following metals is essential to the structure and functioning of hemoglobin? w) copper x) magnesium y) tin z) iron

Last Answer : ANSWER: Z -- IRON

Fluid resistance to shear depends upon its (A) Rate of transfer of molecular momentum (B) Cohesion (C) Both (A) and (B) (D) Neither (A) nor (B)

Description : Fluid resistance to shear depends upon its (A) Rate of transfer of molecular momentum (B) Cohesion (C) Both (A) and (B) (D) Neither (A) nor (B)

Last Answer : (C) Both (A) and (B)

For an ideal gas, the internal energy depends upon its __________ only. (A) Molecular size (B) Temperature (C) Volume (D) Pressure

Description : For an ideal gas, the internal energy depends upon its __________ only. (A) Molecular size (B) Temperature (C) Volume (D) Pressure

Last Answer : (B) Temperature

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape

The internal molecular attraction of a soil, the cohesion (A) Decreases as the moisture content increases (B) Increases as the moisture content decreases (C) Is more in well compacted clays (D) Depends upon the external applied load

Description : The internal molecular attraction of a soil, the cohesion (A) Decreases as the moisture content increases (B) Increases as the moisture content decreases (C) Is more in well compacted clays (D) Depends upon the external applied load

Last Answer : Answer: Option C

A CPA establishes quality control policies and procedures for deciding whether to accept a new client or continue to perform services for a current client. The primary purpose for establishing such policies and procedures is a. To enable the auditor to attest to the integrity or reliability of a client. b. To comply with the quality control standards established by regulatory bodies. c. To minimize the likelihood of association with clients whosemanagement lacks integrity.d. To lessen the exposure to litigationresulting from failure to detectirregularities in client financialstatements

Description : A CPA establishes quality control policies and procedures for deciding whether to accept a new client or continue to perform services for a current client. The primary purpose ... resulting from failure to detect irregularities in client financial statements association with clients whose

Last Answer : To minimize the likelihood of association with clients whose management lacks integrity

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

Given below is the representation of the extent of global diversity of invertebrates. What groups the four portions (A-D) represent respectively? A B C D A B C D (a) Insects Crusta- Other Molluscs ceans animal groups (b) Crustaceans Insects Molluscs Other animal groups (c) Molluscs Other Crusta- Insects animal ceans groups (d) Insects Molluscs Crusta- Other animal ceans groups

Description : Given below is the representation of the extent of global diversity of invertebrates. What groups the four portions (A-D) represent respectively? A B C D A B C D (a) Insects Crusta- ... Molluscs Other Crusta- Insects animal ceans groups (d) Insects Molluscs Crusta- Other animal ceans groups

Last Answer : (d) Insects Molluscs Crusta- Other animal ceans groups

Consider the following statements. (A) Coenzyme or metal ion that is tightly bound to enzyme protein is called prosthetic group. (B) A complete catalytic active enzyme with its bound prosthetic group is called apoenzyme. Select the correct option. (a) (A) is false but (B) is true. (b) Both (A) and (B) are true. (c) (A) is true but (B) is false. (d) Both (A) and (B) are false

Description : Consider the following statements. (A) Coenzyme or metal ion that is tightly bound to enzyme protein is called prosthetic group. (B) A complete catalytic active enzyme with its bound prosthetic group is called apoenzyme. Select the ... ) (A) is true but (B) is false. (d) Both (A) and (B) are false

Last Answer : (d) Both (A) and (B) are false.

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA