Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond
by

1 Answer

Answer :

Answer :  B
by
selected

Related questions

The number of intra-chain disulphide bonds in pro-insulin: (A) One (B) Two (C) Three (D) Four

Description : The number of intra-chain disulphide bonds in pro-insulin: (A) One (B) Two (C) Three (D) Four

Last Answer : Answer : C

At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

Each antibody molecule is made up of how many PAIR of polypeptide chains, joined together by disulfide bonds. a) 1 b) 2 c) 3 d) 4

Description : Each antibody molecule is made up of how many PAIR of polypeptide chains, joined together by disulfide bonds. a) 1 b) 2 c) 3 d) 4

Last Answer : ANSWER: B -- 2

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Description : The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Last Answer : Answer : B

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Description : When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Last Answer : Answer : C

Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Description : Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Last Answer : Answer : A

Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Description : Isoenzymes for a given reaction (A) Have different spedificities (B) Have identical affinities for the same substrate (C) Exhibit different electrophoretic motilities (D) Contain similar ratios of different polypeptide chains

Last Answer : Answer : B

Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide chains. Reason `:` Haemoglobin is a conjugate protein an

Description : Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide chains. Reason `:` Haemoglobin is a conjugate protein an

Last Answer : Assertion `:` Most of the human haemoglobin in our body has `2 alph` and `2 beta` polypeptide ... False. D. If both Assertion & Reason are false.

This hormone has disulphide group: (A) Glucagon (B) Insulin (C) T4 (D) Epinephrine

Description : This hormone has disulphide group: (A) Glucagon (B) Insulin (C) T4 (D) Epinephrine

Last Answer : Answer : B

A disulphide bond can be formed between (A) Two methionine residues (B) Two cysteine residues (C) A methionine and a cysteine residue (D) All of these

Description : A disulphide bond can be formed between (A) Two methionine residues (B) Two cysteine residues (C) A methionine and a cysteine residue (D) All of these

Last Answer : Answer : B

Which of the following does not have disulphide bond? (A) Oxytocin (B) Vasopressin (C) Insulin (D) Glucagon

Description : Which of the following does not have disulphide bond? (A) Oxytocin (B) Vasopressin (C) Insulin (D) Glucagon

Last Answer : Answer : D

A protein reacts with biuret reagent which indicates 2 or more (A) Blood clotting (B) Peptide bond (C) Disulphide bonds (D) Hydrophobic bonds

Description : A protein reacts with biuret reagent which indicates 2 or more (A) Blood clotting (B) Peptide bond (C) Disulphide bonds (D) Hydrophobic bonds

Last Answer : Answer : B

In denaturation of proteins, the bond which is not broken: (A) Disulphide bond (B) Peptide bond (C) Hydrogen bond (D) Ionic bond

Description : In denaturation of proteins, the bond which is not broken: (A) Disulphide bond (B) Peptide bond (C) Hydrogen bond (D) Ionic bond

Last Answer : Answer : B

The bond in proteins that is not broken under usual conditions of denaturation: (A) Hydrophobic bond (B) Hydrogen bond (C) Disulphide bond (D) Peptide bonds

Description : The bond in proteins that is not broken under usual conditions of denaturation: (A) Hydrophobic bond (B) Hydrogen bond (C) Disulphide bond (D) Peptide bonds

Last Answer : Answer : D

The disulphide bond is not broken under the usual conditions of (A) Filtration (B) Reduction (C) Oxidation (D) Denaturation

Description : The disulphide bond is not broken under the usual conditions of (A) Filtration (B) Reduction (C) Oxidation (D) Denaturation

Last Answer : Answer : D

The bond in proteins that is not hydrolysed under usual conditions of denaturation: (A) Hydrophobic bond (B) Hydrogen bond (C) Disulphide bond (D) Peptide bonds

Description : The bond in proteins that is not hydrolysed under usual conditions of denaturation: (A) Hydrophobic bond (B) Hydrogen bond (C) Disulphide bond (D) Peptide bonds

Last Answer : Answer : C

An amino acid which contains a disulphide bond is (A) Lysine (B) Methionine (C) Homocysteine (D) Cystine

Description : An amino acid which contains a disulphide bond is (A) Lysine (B) Methionine (C) Homocysteine (D) Cystine

Last Answer : Answer : D

In a protein molecule the disulphide bond is not broken by (A) Reduction (B) Oxidation (C) Denaturation (D) X-ray diffraction

Description : In a protein molecule the disulphide bond is not broken by (A) Reduction (B) Oxidation (C) Denaturation (D) X-ray diffraction

Last Answer : Answer : C

The a-helix of proteins is (A) A pleated structure (B) Made periodic by disulphide bridges (C) A non-periodic structure (D) Stabilised by hydrogen bonds between NH and CO groups of the main chain

Description : The a-helix of proteins is (A) A pleated structure (B) Made periodic by disulphide bridges (C) A non-periodic structure (D) Stabilised by hydrogen bonds between NH and CO groups of the main chain

Last Answer : Answer : C

The two polypeptides of human insulin are linked together by (a) covalent bond (b) disulphide bridges (c) hydrogen bonds (d) phosphodiester bond.

Description : The two polypeptides of human insulin are linked together by (a) covalent bond (b) disulphide bridges (c) hydrogen bonds (d) phosphodiester bond.

Last Answer : (b) disulphide bridges

The number of polypeptide chains present in a molecule of haemoglobin is/are

Description : The number of polypeptide chains present in a molecule of haemoglobin is/are

Last Answer : The number of polypeptide chains present in a molecule of haemoglobin is/are A. 1 B. 3 C. 4 D. 2

Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four heme groups. As a protein composed of association of polypeptide chains, the functionality of hemoglobin depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule

Description : Hemoglobin is a molecule made of four polypeptide chains, each bound to a iron-containing molecular group called a heme group. So the molecule contains four polypeptide chains and four ... depends upon the integrity of its quaternary structure. Blood Questions - Image Diversity: hemoglobin molecule

Last Answer : On average what is the life duration of the red blood cells?

The following are true about the sodium channels: a. they are made up of polypeptide chains b. have the highest densities at the nodes of Ranvier c. open in response to depolarization d. remain open as long as depolarization is maintained

Description : The following are true about the sodium channels: a. they are made up of polypeptide chains b. have the highest densities at the nodes of Ranvier c. open in response to depolarization d. remain open as long as depolarization is maintained

Last Answer : have the highest densities at the nodes of Ranvier

This pancreatic hormone increases the blood-sugar level: (A) Insulin (B) Glucagon (C) Pancreozymin (D) Pancreatic polypeptide

Description : This pancreatic hormone increases the blood-sugar level: (A) Insulin (B) Glucagon (C) Pancreozymin (D) Pancreatic polypeptide

Last Answer : Answer : B

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Last Answer : Answer : A

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Description : Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Last Answer : Answer : A

In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Description : In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Last Answer : Hydroxyl group of serine or threonine.

9.The reason behind the anti-parallel strand of DNA is 1. Hydrogen bond 2. Ionic bond 3. Phosphodiester bond 4. Disulphide bond

Description : 9.The reason behind the anti-parallel strand of DNA is 1. Hydrogen bond 2. Ionic bond 3. Phosphodiester bond 4. Disulphide bond

Last Answer : Ans: Phosphodiester bond.

Allosteric enzymes contain (A) Multiple subunits (B) Single chain (C) Two chains (D) Three chains

Description : Allosteric enzymes contain (A) Multiple subunits (B) Single chain (C) Two chains (D) Three chains

Last Answer : Answer : A

IgG cleaved by papain into (A) Two light and two heavy chains (B) Two Fab and one Fc fragments (C) Two pairs of one light and one heavy chain each (D) One Fab and two Fc fragments

Description : IgG cleaved by papain into (A) Two light and two heavy chains (B) Two Fab and one Fc fragments (C) Two pairs of one light and one heavy chain each (D) One Fab and two Fc fragments

Last Answer : Answer : B

AUG, the only identified codon for methionine is important as (A) A releasing factor for peptide chains (B) A chain terminating codon (C) Recognition site on tRNA (D) A chain initiating codon

Description : AUG, the only identified codon for methionine is important as (A) A releasing factor for peptide chains (B) A chain terminating codon (C) Recognition site on tRNA (D) A chain initiating codon

Last Answer : Answer : D

In thalassemia, an amino acid is substituted in (A) Alpha chain (B) Beta chain (C) Alpha and beta chains (D) Any chain MINERAL METABOLISM 195

Description : In thalassemia, an amino acid is substituted in (A) Alpha chain (B) Beta chain (C) Alpha and beta chains (D) Any chain MINERAL METABOLISM 195

Last Answer : Answer : D

The portion of the immunoglobulin molecule that binds the specific antigen is formed by (A) Variable regions of H and L chains (B) Constant region of H chain (C) Constant region of L chain (D) Hinge region

Description : The portion of the immunoglobulin molecule that binds the specific antigen is formed by (A) Variable regions of H and L chains (B) Constant region of H chain (C) Constant region of L chain (D) Hinge region

Last Answer : Answer : A

The carbon chains of prostanoic acid are bonded at the middle of the chain by a (A) 5-membered ring (B) 6-membered ring (C) 8-membered ring (D) None of these

Description : The carbon chains of prostanoic acid are bonded at the middle of the chain by a (A) 5-membered ring (B) 6-membered ring (C) 8-membered ring (D) None of these

Last Answer : Answer : B

Which of the following statements concerning abnormalities of the haemoglobin molecule is true? 1) Alpha thalassaemia is due to a deficiency of beta-chain production 2) HbS is caused by a single base mutation on the beta-chain 3) genes for the alpha and beta chains are located on the same chromosome 4) in thalassaemia persistance of HbF is an adverse prognostic sign 5) oliguneoclitide probes may assist in the diagnosis of haemoglobinopathies

Description : Which of the following statements concerning abnormalities of the haemoglobin molecule is true? 1) Alpha thalassaemia is due to a deficiency of beta-chain production 2) HbS is caused by a ... is an adverse prognostic sign 5) oliguneoclitide probes may assist in the diagnosis of haemoglobinopathies

Last Answer : Answers-2 Alpha Thalassaemia is due to abnormalities of the alpha chain. Persistence of HbF has survival advnatages in severely affected subjects. C-alpha 16, beta 11. e-Hb electrophoresis(Dr Shu Ho)

Which of the following is a hormone releasing Intra Uterine Device (IUD)? (a) Multiload 375 (b) LNG - 20 (c) Cervical cap (d) Vault

Description : Which of the following is a hormone releasing Intra Uterine Device (IUD)? (a) Multiload 375 (b) LNG - 20 (c) Cervical cap (d) Vault

Last Answer : b) LNG - 20

Select the hormone-releasing Intra-Uterine Devices. (a) Lippes Loop, Multiload 375 (b) Vaults, LNG-20 (c) Multiload 375, Progestasert (d) Progestasert, LNG-20

Description : Select the hormone-releasing Intra-Uterine Devices. (a) Lippes Loop, Multiload 375 (b) Vaults, LNG-20 (c) Multiload 375, Progestasert (d) Progestasert, LNG-20

Last Answer : (d) Progestasert, LNG-20

Glucagon: a. is secreted by beta-islet cell of pancreas b. is a polypeptide hormone c. has a positive cardiac inotropic effect d. causes gluconeogenesis in the liver e. causes glycogenolysis in the liver

Description : Glucagon: a. is secreted by beta-islet cell of pancreas b. is a polypeptide hormone c. has a positive cardiac inotropic effect d. causes gluconeogenesis in the liver e. causes glycogenolysis in the liver

Last Answer : is a polypeptide hormone

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA