A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides
by

1 Answer

Answer :

Answer :  A
by
selected

Related questions

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape

mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Description : mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Last Answer : Answer : A

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

A polycistronic mRNA can be seen in (A) Prokaryotes (B) Eukaryotes (C) Mitochondria (D) All of these

Description : A polycistronic mRNA can be seen in (A) Prokaryotes (B) Eukaryotes (C) Mitochondria (D) All of these

Last Answer : Answer : A

In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Last Answer : Answer : A

Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Description : Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Last Answer : Answer : D

In eukaryotes, mRNA is synthesised with the aid of

Description : In eukaryotes, mRNA is synthesised with the aid of

Last Answer : In eukaryotes, mRNA is synthesised with the aid of A. RNA polymerase 3 B. RNA polymerase 2 C. RNA polymerase 1 D. Reverse transcriptase

Which sequence in case of eukaryotes is important for MRNA tailing? (a) GAGAGA (b) GAATTC(c) UACGAC (d) UACUAAC

Description : Which sequence in case of eukaryotes is important for MRNA tailing? (a) GAGAGA (b) GAATTC(c) UACGAC (d) UACUAAC

Last Answer : (d) UACUAAC

RNA transcription is more complex in eukaryotes because it is first made as a primary RNA transcript that contains intron and exon sequences. What kind of modification must occur to produce a mature mRNA?

Description : RNA transcription is more complex in eukaryotes because it is first made as a primary RNA transcript that contains intron and exon sequences. What kind of modification must occur to produce a mature mRNA?

Last Answer : RNA splicing. Introns must be removed and exons are spliced together to form a mature RNA transcript.

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Last Answer : (b) polyhedral bodies

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Last Answer : polysome

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome

Last Answer : (1) Polysome

The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Description : The minimum number of polypeptide chains in an immunoglobulin is (A) Two (B) Four (C) Five (D) Six

Last Answer : Answer : B

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

Proteins produce polypeptides from proteins by (A) Oxidizing (B) Reducing (C) Hydrolyzing (D) None of these

Description : Proteins produce polypeptides from proteins by (A) Oxidizing (B) Reducing (C) Hydrolyzing (D) None of these

Last Answer : Answer : C

Polymers of more than 100 amino acids are termed (A) Proteins (B) Polypeptides (C) Both (A) and (B) (D) None of these

Description : Polymers of more than 100 amino acids are termed (A) Proteins (B) Polypeptides (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

Pepsin acts on denatured proteins to produce (A) Proteoses and peptones (B) Polypeptides (C) Peptides (D) Dipeptides

Description : Pepsin acts on denatured proteins to produce (A) Proteoses and peptones (B) Polypeptides (C) Peptides (D) Dipeptides

Last Answer : Answer : A

The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA

Description : The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA

Last Answer : Answer : C

All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) Imprecise recognition of the third base results in wobble (C) Wobble is partly responsible for the degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein

Last Answer : Answer : D

Cytokines are low-molecular-weight polypeptides exerting a wide variety of biologic effects at both local and systemic levels. Which of the following statement(s) is/are true concerning the production and actions of cytokines? a. Cytokines are produced solely by macrophages b. Cytokines act only on other cells within the same local environment c. Cytokines may have both protective and deleterious effects on the host d. Each specific cytokine is produced by a single cell type

Description : Cytokines are low-molecular-weight polypeptides exerting a wide variety of biologic effects at both local and systemic levels. Which of the following statement(s) is/are true concerning the production and ... effects on the host d. Each specific cytokine is produced by a single cell type

Last Answer : Answer: c Macrophages, endothelial cells, lymphocytes, and other cells secrete a large number of different compounds, termed cytokines, that are most probably evolved for the purpose of ... host defenses, exerting both salutatory and deleterious effects on the host, has become increasingly evident

The DNA polymerase commonly used in polymerase chain reaction is obtained from (A) E. coli (B) Yeast (C) T.aquaticus (D) Eukaryotes

Description : The DNA polymerase commonly used in polymerase chain reaction is obtained from (A) E. coli (B) Yeast (C) T.aquaticus (D) Eukaryotes

Last Answer : Answer : C

Restriction endonucleases are present in (A) Viruses (B) Bacteria (C) Eukaryotes (D) All of these

Description : Restriction endonucleases are present in (A) Viruses (B) Bacteria (C) Eukaryotes (D) All of these

Last Answer : Answer : B

All of the following statements about puromycin are true except (A) It is an alanyl tRNA analogue (B) It causes premature termination of protein synthesis (C) It inhibits protein synthesis in prokaryotes (D) It inhibits protein synthesis in eukaryotes

Description : All of the following statements about puromycin are true except (A) It is an alanyl tRNA analogue (B) It causes premature termination of protein synthesis (C) It inhibits protein synthesis in prokaryotes (D) It inhibits protein synthesis in eukaryotes

Last Answer : Answer : A

Puromycin causes premature chain termination in (A) Prokaryotes (B) Eukaryotes (C) Both (A) and (B) (D) None of these

Description : Puromycin causes premature chain termination in (A) Prokaryotes (B) Eukaryotes (C) Both (A) and (B) (D) None of these

Last Answer : Answer : C

In eukaryotes, the 40 S pre-initiation complex contains all the following initiation factors except (A) eIF-1A (B) eIF-2 (C) eIF-3 (D) eIF-4

Description : In eukaryotes, the 40 S pre-initiation complex contains all the following initiation factors except (A) eIF-1A (B) eIF-2 (C) eIF-3 (D) eIF-4

Last Answer : Answer : D

The first amino acyl tRNA which initiates translation in eukaryotes is (A) Mehtionyl tRNA (B) Formylmethionyl tRNA (C) Tyrosinyl tRNA (D) Alanyl tRNA

Description : The first amino acyl tRNA which initiates translation in eukaryotes is (A) Mehtionyl tRNA (B) Formylmethionyl tRNA (C) Tyrosinyl tRNA (D) Alanyl tRNA

Last Answer : Answer : A

Non-coding sequence are present in the genes of (A) Bacteria (B) Viruses (C) Eukaryotes (D) All of these

Description : Non-coding sequence are present in the genes of (A) Bacteria (B) Viruses (C) Eukaryotes (D) All of these

Last Answer : Answer : C

Ciprofloxacin inhibits the synthesis of (A) DNA in prokaryotes (B) DNA in prokaryotes and eukaryotes (C) RNA in prokaryotes (D) RNA in prokaryotes and eukaryotes

Description : Ciprofloxacin inhibits the synthesis of (A) DNA in prokaryotes (B) DNA in prokaryotes and eukaryotes (C) RNA in prokaryotes (D) RNA in prokaryotes and eukaryotes

Last Answer : Answer : A

α-Amanitin inhibits (A) DNA polymerase II of prokaryotes (B) DNA polymerase α of eukaryotes (C) RNA polymerase II of eukaryotes (D) RNA-dependent DNA polymerase

Description : α-Amanitin inhibits (A) DNA polymerase II of prokaryotes (B) DNA polymerase α of eukaryotes (C) RNA polymerase II of eukaryotes (D) RNA-dependent DNA polymerase

Last Answer : Answer : C

Some DNA is present in mitochondria of (A) Prokaryotes (B) Eukaryotes (C) Both (A) and (B) (D) None of these

Description : Some DNA is present in mitochondria of (A) Prokaryotes (B) Eukaryotes (C) Both (A) and (B) (D) None of these

Last Answer : Answer : B

Mitochondrial DNA is present in (A) Bacteria (B) Viruses (C) Eukaryotes (D) All of these

Description : Mitochondrial DNA is present in (A) Bacteria (B) Viruses (C) Eukaryotes (D) All of these

Last Answer : Answer : C

Are prokaryotes and eukaryotes similar in any respects?

Description : Are prokaryotes and eukaryotes similar in any respects?

Last Answer : Prokaryotes and eukaryotes share common features, among them the possession of nucleic acids and other organic substances such as proteins, carbohydrates, and lipids. In addition, they utilize similar ... although the mode of reproduction may be different and different organs of motility may exist.

The two polypeptides of human insulin are linked together by (a) covalent bond (b) disulphide bridges (c) hydrogen bonds (d) phosphodiester bond.

Description : The two polypeptides of human insulin are linked together by (a) covalent bond (b) disulphide bridges (c) hydrogen bonds (d) phosphodiester bond.

Last Answer : (b) disulphide bridges

Why are proteins called polypeptides? -Biology

Description : Why are proteins called polypeptides? -Biology

Last Answer : answer:

What type of RNA makes up the ribosomes that manufacture polypeptides?

Description : What type of RNA makes up the ribosomes that manufacture polypeptides?

Last Answer : Feel Free to Answer

The major constituents in agar are a. Fats b. Aminoacids c. Polysaccharides d. Polypeptides

Description : The major constituents in agar are a. Fats b. Aminoacids c. Polysaccharides d. Polypeptides

Last Answer : Ans: C

The enzyme enterokinase helps in conversion of (a) protein into polypeptides (b) trypsinogen into trypsin (c) caseinogen into casein (d) pepsinogen into pepsin.

Description : The enzyme enterokinase helps in conversion of (a) protein into polypeptides (b) trypsinogen into trypsin (c) caseinogen into casein (d) pepsinogen into pepsin.

Last Answer : (b) trypsinogen into trypsin

Which of the following structures can polypeptides have? (a) primary structure (b) secondary structure (c) tertiary structure (d) all of the these

Description : Which of the following structures can polypeptides have? (a) primary structure (b) secondary structure (c) tertiary structure (d) all of the these

Last Answer : all of the these

Both DNA and RNA are composed of _______ a. polynucleotides b. genes c. polysaccharides d. polypeptides

Description : Both DNA and RNA are composed of _______ a. polynucleotides b. genes c. polysaccharides d. polypeptides

Last Answer : a. polynucleotides

Which statement is NOT true about non-steroid (peptide) hormones? A) They are derived from peptides, proteins, polypeptides, and derivatives of amino acids. B) They bind to receptors on the cell surface. C) They form cyclic AMP inside the cell. D) They create an enzyme cascade effect. E) They enter the cell in order to have an effect.

Description : Which statement is NOT true about non-steroid (peptide) hormones? A) They are derived from peptides, proteins, polypeptides, and derivatives of amino acids. B) They bind to receptors on the cell surface. ... They create an enzyme cascade effect. E) They enter the cell in order to have an effect.

Last Answer : E) They enter the cell in order to have an effect.

Which of the following converts peptones, proteoses and polypeptides into amino acids : (a) Amylase (b) Trypsin (c) Lipase (d) Rennin

Description : Which of the following converts peptones, proteoses and polypeptides into amino acids : (a) Amylase (b) Trypsin (c) Lipase (d) Rennin

Last Answer : (b) Trypsin

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Last Answer : Answer : B

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

Streptomycin prevents synthesis of polypeptide by (A) Inhibiting initiation process (B) Releasing premature polypeptide (C) Inhibiting peptidyl transferase activity (D) Inhibiting translocation

Description : Streptomycin prevents synthesis of polypeptide by (A) Inhibiting initiation process (B) Releasing premature polypeptide (C) Inhibiting peptidyl transferase activity (D) Inhibiting translocation

Last Answer : Answer : A

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C