Description : Ribosomes match up the ______ of the mRNA and the ______ of the tRNAs. a. codons; anticodons b. introns; exons c. anticodons; codons d. genes; anticodons
Last Answer : a. codons; anticodons
Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity
Last Answer : Answer : A
Description : Non-coding sequences in a gene are known as (A) Cistrons (B) Nonsense codons (C) Introns (D) Exons
Last Answer : Answer : C
Description : True statements about the nucleic acid include: a. contains purine and pyrimidine which are bound together by covalent bonds b. there is always an equal concentration of purine and pyrimidine c. in RNA, ... d. introns is more common than exons on the DNA e. the histones mark the excision site
Last Answer : there is always an equal concentration of purine and pyrimidine
Description : A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides
Description : In split genes, the coding sequences are called (a) exons (b) cistrons (c) introns (d) operons
Last Answer : (d) operons.
Description : DNA elements, which can switch their position, are called (a) cistrons (b) transposons (c) exons (d) introns.
Last Answer : (b) transposons
Description : Removal of introns and joining of exons in a defined order during transcription is called (a) looping (b) inducing (c) slicing (d) splicing
Last Answer : (a) looping
Description : In split genes, the coding sequences are called (a) exons (b) cistrons (c) introns (d) operons.
Last Answer : (a) exons
Last Answer : d) splicing.
Description : Bacterial genes lack (a) Exons (b) Introns (c) Prometers (d) Operator
Last Answer : (b) Introns
Description : In a eukaryotic microbe, those sections of a primary RNA transcript that will NOT be translated are called a. Introns. b. Anticodons. c. ―Jumping Genes.‖ d. Exons.
Last Answer : a. Introns.
Description : The coding sequences found in split genes are called a) Operons b) introns c) exons d) cistrons
Last Answer : c) exons
Description : In contrast to Eukaryotic mRNA, prokaryotic mRNA is characterized by (A) Having 7-methyl guanosine triphosphate at the 5’ end (B) Being polycystronic (C) Being only monocystronic (D) Being synthesized with introns
Description : In contrast to eukaryot ic mRNA , prokaryotic mRNA (A) Can be polycistronic (B) Is synthesized with introns (C) Can only be monocistronic (D) Has a poly A tail
Description : What is a difference between prokaryotic and eukaryotic cells in making protein? a. Eukayotes have introns that stay inside the nucleus b. Prokaryotes can transcribe and translate at the same time c. the process is faster in prokaryotes d. A-C are correct
Last Answer : d. A-C are correct
Description : A polycistronic mRNA can be seen in (A) Prokaryotes (B) Eukaryotes (C) Mitochondria (D) All of these
Description : Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA
Last Answer : Answer : D
Description : During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.
Last Answer : (c) association of 30S mRNA with formyl-met- tRNA
Description : .During translation initiation in prokaryotes, a GTP molecule is needed in (a) formation of formyl-met-tRNA (b) binding of 30S subunit of ribosome with mRNA (c) association of 30S mRNA with formyl-met- tRNA (d) association of 50S subunit of ribosome with initiation complex.
Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.
Last Answer : (b) polyhedral bodies
Last Answer : polysome
Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above
Last Answer : c. the amino acids are linked by polypeptide bonds
Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape
Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape
Last Answer : aid a newly synthesized polypeptide in folding to its proper shape
Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis
Last Answer : adaptor hypothesis
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome
Last Answer : (1) Polysome
Description : In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above
Last Answer : all above
Description : The genetic code operates via (A) The protein moiety of DNA (B) The base sequences of DNA (C) The nucleotide sequence of mRNA (D) The base sequence of tRNA
Description : All the following statements about recognition of a codon on mRNA by an anticodon on tRNA are correct except (A) The recognition of the third base of the codon is not very precise (B) ... degeneracy of the genetic code (D) Wobble results in incorporation of incorrect amino acids in the protein
Description : The normal function of restriction endonucleases is to (A) Excise introns from hrRNA (B) Polymerize nucleotides to form RNA (C) Remove primer from okazaki fragments (D) Protect bacteria from foreign DNA
Description : DNA finger printing is based on the presence in DNA of (A) Constant number of tandem repeats (B) Varibale number of tandem repeats (C) Non-repititive sequences in each DNA (D) Introns in eukaryotic DNA
Last Answer : Answer : B
Description : The common features of introns include all the following except (A) The base sequence begins with GU (B) The base sequence ends with AG (C) The terminal AG sequence is preceded by a purine rich tract of ten nucleotides (D) An adenosine residue in branch site participates in splicing
Description : All of the following statements about post-transcriptional processing of tRNA are true except (A) Introns of some tRNA precursors are removed (B) CCA is added at 3′ end (C) 7-Methylguanosine triphosphate cap is added at 5′ end (D) Some bases are methylated
Description : Introns in genes (A) Encode the amino acids which are removed during post-translational modification (B) Encode signal sequences which are removed before secretion of the proteins (C) Are the non-coding sequences which are not translated (D) Are the sequences that intervene between two genes
Description : Introns are present in DNA of (A) Viruses (B) Bacteria (C) Man (D) All of these
Description : Post-transcriptional modification of hnRNA involves all of the following except (A) Addition of 7-methylguanosine triphosphate cap (B) Addition of polyadenylate tail (C) Insertion of nucleotides (D) Deletion of introns
Description : Restriction endonucleases (A) Cut RNA chains at specific locations (B) Excise introns from hnRNA (C) Remove Okazaki fragments (D) Act as defensive enzymes to protect the host bacterial DNA from DNA of foreign organisms
Description : In bacteria a group of genes located together and functioning together on a chromosome are called _____. a. polysome b. operon c. polymerase d. exons
Last Answer : b. operon
Description : In eukaryotic cells (A) Formylated tRNA is important for initiation of translation (B) Cyclohexamide blocks elongation during translation (C) Cytosolic ribosomes are smaller than those found in prokaryotes (D) Erythromycin inhibits elongation during translation
Description : Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10
Description : What is true about ribosomes? (a) The prokaryotic ribosomes are 80S, where “S” stands for sedimentation coefficient. (b) These are composed of ribonucleic acid and proteins. (c) These are found only in eukaryotic cells. (d) These are self-splicing introns of some RNAs
Last Answer : (b) These are composed of ribonucleic acid and proteins.
Description : What is true about ribosomes ? (1) These are self - splicing introns of some RNAs (2) The prokaryotic ribosomes are 80S, where “S” stands for sedimentation coefficient (3) These are composed of ribonucleic acid and proteins (4) These are found only in eukaryotic cells
Last Answer : (3) These are composed of ribonucleic acid and proteins
Description : Proto-oncogens are present in (A) Oncoviruses (B) Cancer cells (C) Healthy human cells (D) Prokaryotes
Description : All of the following statements about puromycin are true except (A) It is an alanyl tRNA analogue (B) It causes premature termination of protein synthesis (C) It inhibits protein synthesis in prokaryotes (D) It inhibits protein synthesis in eukaryotes
Description : Puromycin causes premature chain termination in (A) Prokaryotes (B) Eukaryotes (C) Both (A) and (B) (D) None of these
Description : Binding of formylmehtionyl tRNA to 30 S ribosomal subunit of prokaryotes is inhibited by (A) Streptomycin (B) Chloramphenicol (C) Erythromycin (D) Mitomycin
Description : The first amino acyl tRNA which initiates translation in prokaryotes is (A) Mehtionyl tRNA (B) Formylmethionyl tRNA (C) Tyrosinyl tRNA (D) Alanyl tRNA