Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (1) Polysome (2) Polyhedral bodies (3) Plastidome (4) Nucleosome

Many ribosomes may associate with a single mRNA
to form multiple copies of a polypeptide
simultaneously. Such strings of ribosomes are
termed as
(1) Polysome
(2) Polyhedral bodies
(3) Plastidome
(4) Nucleosome
by

1 Answer

Answer :

(1) Polysome
by

Related questions

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Last Answer : (b) polyhedral bodies

Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Description : Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as (a) polysome (b) polyhedral bodies (c) plastidome (d) nucleosome.

Last Answer : polysome

A complex of ribosomes attached to a single strand of RNA is known as (a) polypeptide (b) Okazaki fragment (c) polysome (d) polymer.

Description : A complex of ribosomes attached to a single strand of RNA is known as (a) polypeptide (b) Okazaki fragment (c) polysome (d) polymer.

Last Answer : (b) Okazaki fragment

.A complex of ribosomes attached to a single strand of RNA is known as (a) polypeptide (b) Okazaki fragment (c) polysome (d) polymer

Description : .A complex of ribosomes attached to a single strand of RNA is known as (a) polypeptide (b) Okazaki fragment (c) polysome (d) polymer

Last Answer : (c) polysome

The translation of a mRNA by multiple ribosomes is called formation. a. Okazaki b. Polysome c. Plasmid d. Transposon

Description : The translation of a mRNA by multiple ribosomes is called formation. a. Okazaki b. Polysome c. Plasmid d. Transposon

Last Answer : b. Polysome

.Polysome is formed by (a) a ribosome with several subunits (b) ribosomes attached to each other in a linear arrangement (c) several ribosomes attached to a single mRNA (d) many ribosomes attached to a strand of endoplasmic reticulum.

Description : .Polysome is formed by (a) a ribosome with several subunits (b) ribosomes attached to each other in a linear arrangement (c) several ribosomes attached to a single mRNA (d) many ribosomes attached to a strand of endoplasmic reticulum.

Last Answer : (c) several ribosomes attached to a single mRNA

Polysome is formed by (a) a ribosome with several subunits (b) ribosomes attached to each other in a linear arrangement (c) several ribosomes attached to a single mRNA (d) many ribosomes attached to a strand of endoplasmic reticulum.

Description : Polysome is formed by (a) a ribosome with several subunits (b) ribosomes attached to each other in a linear arrangement (c) several ribosomes attached to a single mRNA (d) many ribosomes attached to a strand of endoplasmic reticulum.

Last Answer : (c) several ribosomes attached to a single mRNA

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : -aid a newly synthesized polypeptide in folding to its proper shape

The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Description : The role of molecular chaperones is to A-facilitate binding of ribosomes to mRNA B-degrade newly synthesized polypeptides that contain inaccurate sequences C-.facilitate binding of RNA polymerase to DNA D-aid a newly synthesized polypeptide in folding to its proper shape

Last Answer : aid a newly synthesized polypeptide in folding to its proper shape

A group of genes whose activity is coordinated by a DNA site is – (1) operon (2) cistron (3) polysome (4) polypeptide

Description : A group of genes whose activity is coordinated by a DNA site is – (1) operon (2) cistron (3) polysome (4) polypeptide

Last Answer : (1) operon Explanation: The operon is defined as a group of genes whose activity is coordinated by a DNA site. An operon is a functioning unit of genomic DNA containing a cluster ... together in the cytoplasm, or undergo trans-splicing to create monocistronic mR-NAs that are translated separately.

A group of genes whose activity is coordinated by a DNA site is called: (1) operon (2) cistron (3) polysome (4) polypeptide

Description : A group of genes whose activity is coordinated by a DNA site is called: (1) operon (2) cistron (3) polysome (4) polypeptide

Last Answer : operon

The part of the cell which binds to the mRNA during protein systhesis is C A. Golgi bodies B. Lysosomes C. Ribosomes D. Food vacuoles

Description : The part of the cell which binds to the mRNA during protein systhesis is C A. Golgi bodies B. Lysosomes C. Ribosomes D. Food vacuoles

Last Answer : Ribosome

.In the simplest capsid, there is a capsomere at each of the 12 vertices; this capsomere, which is surrounded by five other capsomeres, is termed a A- penton B- polyhedral C- .icosahedral D- .helical

Description : .In the simplest capsid, there is a capsomere at each of the 12 vertices; this capsomere, which is surrounded by five other capsomeres, is termed a A- penton B- polyhedral C- .icosahedral D- .helical

Last Answer : penton

The proceedings of the legislature may be proved by (a) Oral evidence (b) Copy of such proceedings (c) The journals of those bodies or by published Acts or abstracts or by copies purporting to be printed by order of the Government concerned (d) None of these

Description : The proceedings of the legislature may be proved by (a) Oral evidence (b) Copy of such proceedings (c) The journals of those bodies or by published Acts or abstracts or by  copies purporting to be printed by order of the Government concerned (d) None of these

Last Answer : (c) The journals of those bodies or by published Acts or abstracts or by  copies purporting to be printed by order of the Government concerned

Multiple ribosomes working together on one mRNA are called a. polysomes b. multisomes c. polymerases d. A-C are correct

Description : Multiple ribosomes working together on one mRNA are called a. polysomes b. multisomes c. polymerases d. A-C are correct

Last Answer : a. polysomes

The capacity to perform multiple tasks simultaneously is termed as ______ (A) Diligence (B) Versatility (C) Reliability (D) All of the Above

Description : The capacity to perform multiple tasks simultaneously is termed as ______ (A) Diligence (B) Versatility (C) Reliability (D) All of the Above

Last Answer : (B) Versatility

mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Description : mRNA of prokaryotes can code for (A) More than one polypeptide (B) Only one polypeptide (C) Many exons and introns (D) Introns only

Last Answer : Answer : A

A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Description : A mRNA of eukaryotes can code for (A) Only one polypeptide (B) Two polypeptides (C) Three polypeptides (D) Five polypeptides

Last Answer : Answer : A

In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Last Answer : Answer : A

Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Description : Tetracylin prevents synthesis of polypeptide by (A) Blocking mRNA formation from DNA (B) Releasing peptides from mRNA-tRNA complex (C) Competing with mRNA for ribosomal binding sites (D) Preventing binding of aminoacyl tRNA

Last Answer : Answer : D

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

A library composed of complementary copies of cellular mRNA

Description : A library composed of complementary copies of cellular mRNA

Last Answer : Ans. cDNA

Best Evidence Rule states that… a. It states that multiple copies of electronic files may be a part of the “original” or equivalent to the “original.” b. It states that copy of evidence may be considered as original evidence. c. It states that the multiple copies of evidence may be part of the “original” or equivalent to the “original.” d. It states that multiple copies of electronic files may be a part of the “original” or same as “original.”

Description : Best Evidence Rule states that a. It states that multiple copies of electronic files may be a part of the original or equivalent to the original. b. It states that copy of evidence may be ... that multiple copies of electronic files may be a part of the original or same as original.

Last Answer : It states that multiple copies of electronic files may be a part of the “original” or equivalent to the “original.”

Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Description : Transfer RNA transfers (A) Information from DNA to ribosomes (B) Information from mRNA to cytosol (C) Amino acids from cytosol to ribosomes (D) Proteins from ribosomes to cytosol

Last Answer : Answer : C

The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Description : The role of transfer RNS (IRNA) is to (a) Transfer mRNA from the nucleus to the cytoplasm (b) Carry amino acids from the cytoplasm to the nucleus (c) Carry the newly synthesised protein to its site of function in the cell (d) Transport amino acids to ribosomes

Last Answer : Ans:(d)

Synapsis occurs between (a) mRNA and ribosomes (b) spindle fibres and centromere (c) two homologous chromosomes (d) a male and a female gamete.

Description : Synapsis occurs between (a) mRNA and ribosomes (b) spindle fibres and centromere (c) two homologous chromosomes (d) a male and a female gamete.

Last Answer : (c) two homologous chromosomes

Polyribosomes are aggregates of (a) ribosomes and rRNA (b) only rRNA (c) peroxisomes (d) several ribosomes held together by string of mRNA.

Description : Polyribosomes are aggregates of (a) ribosomes and rRNA (b) only rRNA (c) peroxisomes (d) several ribosomes held together by string of mRNA.

Last Answer : (d) several ribosomes held together by string of mRNA

Ribosomes match up the ______ of the mRNA and the ______ of the tRNAs. a. codons; anticodons b. introns; exons c. anticodons; codons d. genes; anticodons

Description : Ribosomes match up the ______ of the mRNA and the ______ of the tRNAs. a. codons; anticodons b. introns; exons c. anticodons; codons d. genes; anticodons

Last Answer : a. codons; anticodons

Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Description : Which of the following act as the blueprint or template for the process of protein synthesis that takes place on ribosomes? A.rRNA B.DNA C.tRNA D.mRNA

Last Answer : mRNA

Hepatic cells of rabbit are in the form of (a) Rounded hepatocytes (b) Irregular hepatocytes (c) Discoidal hepatocytes (d) Polyhedral radiating hepatocytes

Description : Hepatic cells of rabbit are in the form of (a) Rounded hepatocytes (b) Irregular hepatocytes (c) Discoidal hepatocytes (d) Polyhedral radiating hepatocytes

Last Answer : (d) Polyhedral radiating hepatocytes

Nondisjunction of a chromosome results in which of the following diagnoses? a) Down Syndrome When a pair of chromosomes fails to separate completely and creates a sperm or oocyte that contains two copies of a particular chromosome (nondisjunction) Down syndrome results from three number 21 chromosomes. b) Huntingon Disease Huntington disease is one example of a germ-line mutation. c) Duchenne Muscular Dystrophy Duchenne muscular dystrophy, an inherited form of muscular dystrophy, is an example of a genetic caused by structural gene mutations. d) Marphan Syndrome Marphan Syndrome is a genetic condition that may occur in a single family member as a result of spontaneous mutation.

Description : Nondisjunction of a chromosome results in which of the following diagnoses? a) Down Syndrome When a pair of chromosomes fails to separate completely and creates a sperm or oocyte that contains two ... genetic condition that may occur in a single family member as a result of spontaneous mutation.

Last Answer : a) Down Syndrome When a pair of chromosomes fails to separate completely and creates a sperm or oocyte that contains two copies of a particular chromosome (nondisjunction) Down syndrome results from three number 21 chromosomes.

Site of enzyme synthesis in a cell is (A) Ribosomes (B) RER (C) Golgi bodies (D) All of these

Description : Site of enzyme synthesis in a cell is (A) Ribosomes (B) RER (C) Golgi bodies (D) All of these

Last Answer : Answer : B

The cellular organelles called “suicide bags” are (A) Lysosomes (B) Ribosomes (C) Nucleolus (D) Golgi’s bodies

Description : The cellular organelles called “suicide bags” are (A) Lysosomes (B) Ribosomes (C) Nucleolus (D) Golgi’s bodies

Last Answer : A

Endoplasmic reticulum remain in continuation with: (a) nucleus (b) Ribosomes (c) Mitochondria (d) Golgi bodies

Description : Endoplasmic reticulum remain in continuation with: (a) nucleus (b) Ribosomes (c) Mitochondria (d) Golgi bodies

Last Answer : Ans. ((a))

The power house of energy in cells is (a) Golgi bodies (b) Mitochondria (c) Ribosomes (d) Endoplasmic reticulum

Description : The power house of energy in cells is (a) Golgi bodies (b) Mitochondria (c) Ribosomes (d) Endoplasmic reticulum

Last Answer : Ans:(b)

Which of the following is known as ‘suicide bags of the cell’? (1) Mitochondria (2) Golgi Bodies (3) Lysosomes (4) Ribosomes

Description : Which of the following is known as ‘suicide bags of the cell’? (1) Mitochondria (2) Golgi Bodies (3) Lysosomes (4) Ribosomes

Last Answer : (3) Lysosomes Explanation: Lysosomes are a kind of waste disposal system of the cell. It contains digestive enzymes for almost all types of organic materials.

ATP is generated in a. ribosomes b. polysomes c. mitochondria d. golgi bodies

Description : ATP is generated in a. ribosomes b. polysomes c. mitochondria d. golgi bodies

Last Answer : mitochondria

Enzymes involved in krebs cycle are localized in a. ribosomes b. mitochondria c. polysomes d. golgi bodies

Description : Enzymes involved in krebs cycle are localized in a. ribosomes b. mitochondria c. polysomes d. golgi bodies

Last Answer : mitochondria

Which part of the plant cell is known as power house? (A)Golgi bodies (B) Ribosomes (C)Mitochondria (D) Lysosomes

Description : Which part of the plant cell is known as power house? (A)Golgi bodies (B) Ribosomes (C)Mitochondria (D) Lysosomes

Last Answer : (C)Mitochondria

Proteins are synthesized in— (A) Centrosomes (B) Ribosomes (C) Mitochondria (D) Golgi bodies

Description : Proteins are synthesized in— (A) Centrosomes (B) Ribosomes (C) Mitochondria (D) Golgi bodies

Last Answer : (B) Ribosomes

Nissl’s bodies are mainly composed of (a) proteins and lipids (b) DNA and RNA (c) nucleic acids and SER (d) free ribosomes and RER.

Description : Nissl’s bodies are mainly composed of (a) proteins and lipids (b) DNA and RNA (c) nucleic acids and SER (d) free ribosomes and RER.

Last Answer : (d) free ribosomes and RER.

The proteins are synthesised at (a) centrosomes (b) Golgi bodies (c) ribosomes (d) mitochondria.

Description : The proteins are synthesised at (a) centrosomes (b) Golgi bodies (c) ribosomes (d) mitochondria.

Last Answer : (c) ribosomes

Nissl bodies are mainly composed of (1) Proteins and lipids (2) DNA and RNA (3) Nucleic acids and SER (4) Free ribosomes and RER

Description : Nissl bodies are mainly composed of (1) Proteins and lipids (2) DNA and RNA (3) Nucleic acids and SER (4) Free ribosomes and RER

Last Answer : (4) Free ribosomes and RER

The diffraction observed by diffraction grating can also be Termed as __________. A. Single slit diffraction B. double slit Diffraction C. multiple Slit Diffraction D. Fresnel’s Diffraction

Description : The diffraction observed by diffraction grating can also be Termed as __________. A. Single slit diffraction B. double slit Diffraction C. multiple Slit Diffraction D. Fresnel’s Diffraction

Last Answer : A. Single slit diffraction

Activities which can be accomplished simultaneously are termed as ___________. A. Preceeding Activities. B. Succeeding Activities. C. Concurrent Activities D. Dummy Activities.

Description : Activities which can be accomplished simultaneously are termed as ___________. A. Preceeding Activities. B. Succeeding Activities. C. Concurrent Activities D. Dummy Activities.

Last Answer : C. Concurrent Activities

Ok, how can I put multiple copies of myself in one video like in this video?

Description : Ok, how can I put multiple copies of myself in one video like in this video?

Last Answer : answer:Greenscreen. But really harlem shake is already dead, you’re too late.

When I delete an e-mail in Thunderbird, multiple copies of the deleted e-mail show up in my trash can. Why?

Description : When I delete an e-mail in Thunderbird, multiple copies of the deleted e-mail show up in my trash can. Why?

Last Answer : Are they all Thunderbird? Or do you have multiple browser clients that are deleting the same email?