Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
by

1 Answer

Answer :

Answer : C
by
selected

Related questions

Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84

Description : Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84

Last Answer : Answer : A

The number of amino acid residues in PTH: (A) 51 (B) 84 (C) 90 (D) 115

Description : The number of amino acid residues in PTH: (A) 51 (B) 84 (C) 90 (D) 115

Last Answer : Answer : B

Number of amino acid residues in prolactin is (A) 51 (B) 84 (C) 191 (D) 198

Description : Number of amino acid residues in prolactin is (A) 51 (B) 84 (C) 191 (D) 198

Last Answer : Answer : D

Number of amino acid residues in human growth hormone is (A) 51 (B) 84 (C) 191 (D) 198

Description : Number of amino acid residues in human growth hormone is (A) 51 (B) 84 (C) 191 (D) 198

Last Answer : Answer : C

The number of amino acid residues in preproinsulin is (A) 51 (B) 84 (C) 109 (D) 119

Description : The number of amino acid residues in preproinsulin is (A) 51 (B) 84 (C) 109 (D) 119

Last Answer : Answer : C

The number of amino acid residues in calcitonin in (A) 9 (B) 32 (C) 51 (D) 84

Description : The number of amino acid residues in calcitonin in (A) 9 (B) 32 (C) 51 (D) 84

Last Answer : Answer : B

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Description : In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Last Answer : Hydroxyl group of serine or threonine.

Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38

Description : Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38

Last Answer : Answer : B

With regard to insulin: a. it is a 51 amino acid peptide b. it is formed by removal of C-chain from proinsulin c. it is produced by the alpha cells of the pancreas d. it alters the rate of enzyme synthesis

Description : With regard to insulin: a. it is a 51 amino acid peptide b. it is formed by removal of C-chain from proinsulin c. it is produced by the alpha cells of the pancreas d. it alters the rate of enzyme synthesis

Last Answer : it alters the rate of enzyme synthesis

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Pre-proinsulin contains a signal sequence having (A) 9 amino acid residues (B) 19 amino acid residues (C) 27 amino acid residues (D) 33 amino acid residues

Description : Pre-proinsulin contains a signal sequence having (A) 9 amino acid residues (B) 19 amino acid residues (C) 27 amino acid residues (D) 33 amino acid residues

Last Answer : Answer : B

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

The number of amino acids in pre-pro insulin is (A) 51 (B) 86 (C) 109 (D) 132

Description : The number of amino acids in pre-pro insulin is (A) 51 (B) 86 (C) 109 (D) 132

Last Answer : Answer : C

In the B chain of insulin molecule, the C-terminal amino acid: (A) Threonine (B) Tyrosine (C) Glutamate (D) Valine

Description : In the B chain of insulin molecule, the C-terminal amino acid: (A) Threonine (B) Tyrosine (C) Glutamate (D) Valine

Last Answer : Answer : A

In the B chain of insulin molecule, the Nterminal amino acid is (A) Proline (B) Threonine (C) Phenylalanine (D) Lysine

Description : In the B chain of insulin molecule, the Nterminal amino acid is (A) Proline (B) Threonine (C) Phenylalanine (D) Lysine

Last Answer : Answer : C

In the A chain of insulin molecule the Cterminal amino acid is (A) Asparagine (B) Threonine (C) Valine (D) Tyrosine

Description : In the A chain of insulin molecule the Cterminal amino acid is (A) Asparagine (B) Threonine (C) Valine (D) Tyrosine

Last Answer : Answer : A

In A chain of the insulin molecule the Nterminal amino acid is (A) Glycine (B) Valine (C) Serine (D) Phenylalanine

Description : In A chain of the insulin molecule the Nterminal amino acid is (A) Glycine (B) Valine (C) Serine (D) Phenylalanine

Last Answer : Answer : A

The sequence of amino acid in which the biological value of parathormone is (A) 1–15 (B) 1–34 (C) 30–50 (D) 50–84

Description : The sequence of amino acid in which the biological value of parathormone is (A) 1–15 (B) 1–34 (C) 30–50 (D) 50–84

Last Answer : Answer : B

Glycoproteins are marked for destruction by removal of their (A) Oligosaccharide prosthetic group (B) Sialic acid residues (C) Mannose residues (D) N-terminal amino acids

Description : Glycoproteins are marked for destruction by removal of their (A) Oligosaccharide prosthetic group (B) Sialic acid residues (C) Mannose residues (D) N-terminal amino acids

Last Answer : Answer : D

Amino acid residues which are essential for the biological activity of PTH are (A) N-terminal 34 amino acids (B) N-terminal 50 amino acids (C) C-terminal 34 amino acids (D) C-terminal 50 amino acids

Description : Amino acid residues which are essential for the biological activity of PTH are (A) N-terminal 34 amino acids (B) N-terminal 50 amino acids (C) C-terminal 34 amino acids (D) C-terminal 50 amino acids

Last Answer : Answer : A

Edman’s reaction can be used to (A) Determine the number of tyrosine residues in a protein (B) Determine the number of aromatic amino acid residues in a protein (C) Determine the amino acid sequence of a protein (D) Hydrolyse the peptide bonds in a protein

Description : Edman’s reaction can be used to (A) Determine the number of tyrosine residues in a protein (B) Determine the number of aromatic amino acid residues in a protein (C) Determine the amino acid sequence of a protein (D) Hydrolyse the peptide bonds in a protein

Last Answer : Answer : C

Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues

Description : Chymotrypsin is specific for peptide bonds containing (A) Uncharged amino acid residues (B) Acidic amino acids (C) Basic amino acid (D) Small amino acid residues

Last Answer : Answer : A

The enzyme trypsin is specific for peptide bonds of (A) Basic amino acids (B) Acidic amino acids (C) Aromatic amino acids (D) Next to small amino acid residues

Description : The enzyme trypsin is specific for peptide bonds of (A) Basic amino acids (B) Acidic amino acids (C) Aromatic amino acids (D) Next to small amino acid residues

Last Answer : Answer : A

Each turn of α-helix contains the amino acid residues (number): (A) 3.6 (B) 3.0 (C) 4.2 (D) 4.5

Description : Each turn of α-helix contains the amino acid residues (number): (A) 3.6 (B) 3.0 (C) 4.2 (D) 4.5

Last Answer : Answer : A

Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Description : Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Last Answer : Answer : A

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Description : The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

Last Answer : Answer : D

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

This pancreatic hormone increases the blood-sugar level: (A) Insulin (B) Glucagon (C) Pancreozymin (D) Pancreatic polypeptide

Description : This pancreatic hormone increases the blood-sugar level: (A) Insulin (B) Glucagon (C) Pancreozymin (D) Pancreatic polypeptide

Last Answer : Answer : B

The α-cells of pancreas islets produce (A) Insulin (B) Glucagon (C) Somatostatin (D) Pancreatic polypeptide

Description : The α-cells of pancreas islets produce (A) Insulin (B) Glucagon (C) Somatostatin (D) Pancreatic polypeptide

Last Answer : Answer : B

β-cells of islet of langerhans of the pancreas secrete (A) Insulin (B) Glucagon (C) Somatostatin (D) Pancreatic polypeptide

Description : β-cells of islet of langerhans of the pancreas secrete (A) Insulin (B) Glucagon (C) Somatostatin (D) Pancreatic polypeptide

Last Answer : Answer : A

The covalent bond that is repeatedly present between different amino acid residues in a protein is called (a) p-bond (b) hydrogen bond (c) peptide bond (d) metallic bond

Description : The covalent bond that is repeatedly present between different amino acid residues in a protein is called (a) p-bond (b) hydrogen bond (c) peptide bond (d) metallic bond

Last Answer : Ans:(c)

An amino acid having a hydrophilic side chain is (A) Alanine (B) Proline (C) Methionine (D) Serine

Description : An amino acid having a hydrophilic side chain is (A) Alanine (B) Proline (C) Methionine (D) Serine

Last Answer : Answer : D

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Last Answer : Answer : A

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Last Answer : Answer : B

At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Description : Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Last Answer : Answer : A

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis