The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid

The end product of protein digestion in G.I.T. is (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) Amino acid
by

1 Answer

Answer :

Answer : D
by
selected

Related questions

Glutathione is a (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) None of these

Description : Glutathione is a (A) Dipeptide (B) Tripeptide (C) Polypeptide (D) None of these

Last Answer : Answer : B

When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Description : When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Last Answer : Answer : C

Thyrotropin releasing hormone is a (A) Dipeptide (B) Tripeptide (C) Octapeptide (D) Decapeptide

Description : Thyrotropin releasing hormone is a (A) Dipeptide (B) Tripeptide (C) Octapeptide (D) Decapeptide

Last Answer : Answer : B

Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Description : Nonsense codons bring about (A) Amino acid activation (B) Initiation of protein synthesis (C) Termination of protein synthesis (D) Elongation of polypeptide chains

Last Answer : Answer : C

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Description : Adrenocorticotropic hormone (ACTH) is a single polypeptide containing (A) 25 amino acid (B) 39 amino acid (C) 49 amino acid (D) 52 amino acid 208 MCQs IN BIOCHEMISTRY

Last Answer : Answer : B

The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a bacterium is (A) N formyl methionine (B) Methionine (C) Alamine (D) Glycine

Last Answer : Answer : A

The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Description : The first amino acid incorporated in a polypeptide in a ribosome of a human is (A) N formyl methionine (B) Methionine (C) Phenyl alanine (D) Hydroxy lysine

Last Answer : Answer : B

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

In glutathione (a tripeptide) is present apart from Glutamic acid and cysteine: (A) Serine (B) Glycine (C) Leucine (D) Phenyl alanine

Description : In glutathione (a tripeptide) is present apart from Glutamic acid and cysteine: (A) Serine (B) Glycine (C) Leucine (D) Phenyl alanine

Last Answer : Answer : B

Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Description : Insulin is oxidized to separate the protein molecule into its constituent polypeptide chains without affecting the other part of the molecule by the use of (A) Performic acid (B) Oxalic acid (C) Citric acid (D) Malic acid

Last Answer : Answer : A

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids

Last Answer : Answer : C

CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : B

ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids

Last Answer : Answer : A

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Description : N-terminal amino acids of a polypeptide are estimated by (A) Edmann reaction (B) Sanger’s reagent (C) Formaldehyde test (D) Ninhydrine reaction

Last Answer : Answer : A

Which of the following is a dipeptide? (A) Anserine (B) Glutathione (C) Glucagon (D) β -Lipoprotein

Description : Which of the following is a dipeptide? (A) Anserine (B) Glutathione (C) Glucagon (D) β -Lipoprotein

Last Answer : Answer : A

What is a dipeptide?

Description : What is a dipeptide?

Last Answer : Two amino acids are combined to form a dipep- tide

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Description : The interaction between the mRNA and tRNA determined the position of amino acid in a polypeptide sequence. This is called the A- stagerivity B- Wobble hypothesis C- Promiscuity D- adaptor hypothesis

Last Answer : adaptor hypothesis

Met-enkephalin is a (A) Tripeptide (B) Pentapeptide (C) Octapeptide (D) Decapeptide

Description : Met-enkephalin is a (A) Tripeptide (B) Pentapeptide (C) Octapeptide (D) Decapeptide

Last Answer : Answer : B

A tripeptide functioning as an important reducing agent in the tissues is (A) Bradykinin (B) Kallidin (C) Tyrocidin (D) Glutathione

Description : A tripeptide functioning as an important reducing agent in the tissues is (A) Bradykinin (B) Kallidin (C) Tyrocidin (D) Glutathione

Last Answer : Answer : D

Which of the following is a tripeptide? (A) Anserine (B) Oxytocin (C) Glutathione (D) Kallidin

Description : Which of the following is a tripeptide? (A) Anserine (B) Oxytocin (C) Glutathione (D) Kallidin

Last Answer : Answer : C

Digestion of protein-is necessary because (a)It not absorbed as such (b)Proteins are large molecules. (c) Proteins have complex structure. (d) Proteins are made of amino acids

Description : Digestion of protein-is necessary because (a)It not absorbed as such (b)Proteins are large molecules. (c) Proteins have complex structure. (d) Proteins are made of amino acids

Last Answer : (a)It not absorbed as such

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

What is the difference between a polypeptide and a protein?

Description : What is the difference between a polypeptide and a protein?

Last Answer : A combination of 10 to 50 amino acids is called a polypeptide. By convention, chains containing more than 50 amino acids are called proteins.

The end product of amino acid nitrogen metabolism in uricotelic organisms (reptiles and birds) is (A) Bilirubin (B) Urea (C) Uric acid (D) Biliverdin

Description : The end product of amino acid nitrogen metabolism in uricotelic organisms (reptiles and birds) is (A) Bilirubin (B) Urea (C) Uric acid (D) Biliverdin

Last Answer : Answer : C

In human and other ureotelic organisms, the end product of amino acid nitrogen metabolism: (A) Bile acids (B) Ketone bodies (C) Urea (D) Barium sulphate

Description : In human and other ureotelic organisms, the end product of amino acid nitrogen metabolism: (A) Bile acids (B) Ketone bodies (C) Urea (D) Barium sulphate

Last Answer : Answer : C

The following receptor type has 7 helical membrane spanning amino acid segments with 3 extracellular and 3 intracellular loops: A. Tyrosine protein kinase receptor B. Gene expression regulating receptor C. Intrinsic ion channel containing receptor D. G protein coupled receptor

Description : Receptors perform the following function/functions: A. Ligand recognition B. Signal transduction C. Both ligand recognition and signal transduction D. Disposal of agonists and antagonists

Last Answer : D. Disposal of agonists and antagonists

The following receptor type has 7 helical membrane spanning amino acid segments with 3 extracellular and 3 intracellular loops: A. Tyrosine protein kinase receptor B. Gene expression regulating receptor C. Intrinsic ion channel containing receptor D. G protein coupled receptor

Description : The following receptor type has 7 helical membrane spanning amino acid segments with 3 extracellular and 3 intracellular loops: A. Tyrosine protein kinase receptor B. Gene expression regulating receptor C. Intrinsic ion channel containing receptor D. G protein coupled receptor

Last Answer : D. G protein coupled receptor

calculation of amino acids from a polypeptide

Description : The gene for urcity polypeptide contains 450 nucleotide pairs. Calculate how many amino acids this polypeptide contains. It has to come out 150 I don't know how to calculate. Thank you very much for your help.

Last Answer : It should have something to do with the fact that each AMK is represented by a triplet (three proteins). so about only 450/3 = 150

What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (b) Two polypeptides of 24 and 25 amino acids will be formed.

.What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and 25 amino acids will be formed. (c) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Description : .What would happen if in a gene encoding a polypeptide of 50 amino acids, 25th codon (UAU) is mutated to UAA? (a) A polypeptide of 24 amino acids will be formed. (b) Two polypeptides of 24 and ... ) A polypeptide of 49 amino acids will be formed. (d) A polypeptide of 25 amino acids will be formed.

Last Answer : (a) A polypeptide of 24 amino acids will be formed.

Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Description : Which of the following biomolecules does have a phosphodiester bond? (a) Amino acids in a polypeptide (b) Nucleic acids in a nucleotide (c) Fatty acids in a diglyceride (d) Monosaccharides in a polysaccharide

Last Answer : b) Nucleic acids in a nucleotide

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

After digestion amino acids (A) Are absorbed into portal circulation (B) Are absorbed into lymph (C) Are excreted to the extent of 50% (D) Converted into glucose in the intestine

Description : After digestion amino acids (A) Are absorbed into portal circulation (B) Are absorbed into lymph (C) Are excreted to the extent of 50% (D) Converted into glucose in the intestine

Last Answer : Answer : A

Amino acids are a product of the digestion of _____ A. Carbohydrates B. Fats C. Vitamins D. Proteins

Description : Amino acids are a product of the digestion of _____ A. Carbohydrates B. Fats C. Vitamins D. Proteins

Last Answer : ANSWER: D

Uric acid is the end product of purine as well as protein catabolism in (A) Man (B) Fish (C) Birds (D) None of these

Description : Uric acid is the end product of purine as well as protein catabolism in (A) Man (B) Fish (C) Birds (D) None of these

Last Answer : Answer : C

The major end product of protein nitrogen metabolism in man is (A) Glycine (B) Uric acid (C) Urea (D) NH3

Description : The major end product of protein nitrogen metabolism in man is (A) Glycine (B) Uric acid (C) Urea (D) NH3

Last Answer : Answer : C

How many high-energy phosphate bond equivalents are required for amino acid activation in protein synthesis? (A) One (B) Two (C) Three (D) Four

Description : How many high-energy phosphate bond equivalents are required for amino acid activation in protein synthesis? (A) One (B) Two (C) Three (D) Four

Last Answer : Answer : B

In E. coli the chain initiating amino acid in protein synthesis is (A) N-formyl methionine(B) Methionine (C) Serine (D) Cysteine

Description : In E. coli the chain initiating amino acid in protein synthesis is (A) N-formyl methionine(B) Methionine (C) Serine (D) Cysteine

Last Answer : Answer : A

Insertion of a base in a gene can cause (A) Change in reading frame (B) Garbled amino acid sequence in the encoded protein (C) Premature termination of translation (D) All of these

Description : Insertion of a base in a gene can cause (A) Change in reading frame (B) Garbled amino acid sequence in the encoded protein (C) Premature termination of translation (D) All of these

Last Answer : Answer : D

Amino acid sequence of the encoded protein is not changed in (A) Silent mutation (B) Acceptable mis-sense mutation (C) Both (A) and (B) (D) None of these

Description : Amino acid sequence of the encoded protein is not changed in (A) Silent mutation (B) Acceptable mis-sense mutation (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

The half-life of a protein depends upon its (A) Signal sequence (B) N-terminus amino acid (C) C-terminus amino acid (D) Prosthetic group

Description : The half-life of a protein depends upon its (A) Signal sequence (B) N-terminus amino acid (C) C-terminus amino acid (D) Prosthetic group

Last Answer : Answer : B

Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Description : Initiation of protein synthesis begins with binding of (A) 40S ribosomal unit on mRNA (B) 60S ribosomal unit (C) Charging of tRNA with specific amino acid (D) Attachment of aminoacyl tRNA on mRNA

Last Answer : Answer : A

A non essential amino acid is not (A) Absorbed in the intestines (B) Required in the diet (C) Incorporated into the protein (D) Metabolized by the body

Description : A non essential amino acid is not (A) Absorbed in the intestines (B) Required in the diet (C) Incorporated into the protein (D) Metabolized by the body

Last Answer : Answer : B