Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10

Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10
by

1 Answer

Answer :

Answer : A
by
selected

Related questions

A coiled structure in which peptide bonds are folded in regular manner by (A) Globular proteins (B) Fibrous proteins (C) Both (A) and (B) (D) None of these

Description : A coiled structure in which peptide bonds are folded in regular manner by (A) Globular proteins (B) Fibrous proteins (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

Fibrous proteins have axial ratio (A) Less than 10 (B) Less than 10 and generally not greater than 3–4 (C) Generally 10 (D) Greater than 10

Description : Fibrous proteins have axial ratio (A) Less than 10 (B) Less than 10 and generally not greater than 3–4 (C) Generally 10 (D) Greater than 10

Last Answer : Answer : D

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Description : When egg albumin is heated till it is coagulated, the secondary and tertiary structures of the proteins are completely lost resulting in a mixture of randomly arranged (A) Dipeptide chains (B) Tripeptide chains (C) Polypeptide chains(D) All of these

Last Answer : Answer : C

Many globular proteins are stable in solution although they lack in (A) Hydrogen bonds (B) Salt bonds (C) Non-polar bonds (D) Disulphide bonds

Description : Many globular proteins are stable in solution although they lack in (A) Hydrogen bonds (B) Salt bonds (C) Non-polar bonds (D) Disulphide bonds

Last Answer : Answer : D

Many globular proteins are stable in solution inspite they lack in (A) Disulphide bonds (B) Hydrogen bonds (C) Salt bonds (D) Non polar bonds

Description : Many globular proteins are stable in solution inspite they lack in (A) Disulphide bonds (B) Hydrogen bonds (C) Salt bonds (D) Non polar bonds

Last Answer : Answer : A

A closely coiled helical spring of radius R, contains n turns and is subjected to an axial load W. If the radius of the coil wire is r and modulus of rigidity of the coil material is C, the deflection of the coil is (A) WR3n/Cr4 (B) 2WR3n/Cr4 (C) 3WR3n/Cr4 (D) 4WR3n/Cr

Description : A closely coiled helical spring of radius R, contains n turns and is subjected to an axial load W. If  the radius of the coil wire is r and modulus of rigidity of the coil material is C, the deflection of the  coil is  (A) WR3n/Cr4 (B) 2WR3n/Cr4 (C) 3WR3n/Cr4 (D) 4WR3n/Cr

Last Answer : (D) 4WR3n/Cr

A closely coiled helical spring of radius R, contains n turns and is subjected to an axial loadW. If the radius of the coil wire is r and modulus of rigidity of the coil material is C, the stress developed in the helical spring is (A) WR/ 3 (B) 2WR/ 3 (C) 2WR/ 2 (D) 4WR/ 2

Description : A closely coiled helical spring of radius R, contains n turns and is subjected to an axial loadW. If the radius of the coil wire is r and modulus of rigidity of the coil material is C, the stress developed in the helical spring is (A) WR/ 3 (B) 2WR/ 3 (C) 2WR/ 2 (D) 4WR/ 2

Last Answer : (B) 2WR/ 3

Wahl’s stress concentration factor is used in close coiled springs under axial load to account for (a) Shear effect (b) Bending effect (c) Compression effect (d) none

Description : Wahl’s stress concentration factor is used in close coiled springs under axial load to account for (a) Shear effect (b) Bending effect (c) Compression effect (d) none

Last Answer : (b) Bending effect

A close coiled spring under axial load produces (a) Bending stresses (b) Shear stresses (c) Tensile stresses (d) None

Description : A close coiled spring under axial load produces (a) Bending stresses (b) Shear stresses (c) Tensile stresses (d) None

Last Answer : (b) Shear stresses

When a close-coiled helical spring is subjected to an axial load, it is said to be under. (a) Bending (b) Shear (c) Torsion (d) Crushing

Description : When a close-coiled helical spring is subjected to an axial load, it is said to be under. (a) Bending (b) Shear (c) Torsion (d) Crushing

Last Answer : (c) Torsion

Difference between fibrous proteins and globular proteins? -Biology

Description : Difference between fibrous proteins and globular proteins? -Biology

Last Answer : answer:

In many proteins the hydrogen bonding produces a regular coiled arrangement which is called as (A) β-Helix (B) α-Helix (C) Both (A) and (B) (D) Spiral

Description : In many proteins the hydrogen bonding produces a regular coiled arrangement which is called as (A) β-Helix (B) α-Helix (C) Both (A) and (B) (D) Spiral

Last Answer : Answer : B

In many proteins the hydrogen bonding produces a regular coiled arrangement called (A) α-helix (B) β-helix (C) Both (A) and (B) (D) None of these

Description : In many proteins the hydrogen bonding produces a regular coiled arrangement called (A) α-helix (B) β-helix (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

Tapered roller bearings can take (a) radial load only (b) axial load only (c) both radial and axial loads and the ratio of these being greater than unity (d) both radial and axial loads and the ratio of these being less than unity

Description : Tapered roller bearings can take (a) radial load only (b) axial load only (c) both radial and axial loads and the ratio of these being greater than unity (d) both radial and axial loads and the ratio of these being less than unity

Last Answer : (c) both radial and axial loads and the ratio of these being greater than unity

In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity

Last Answer : Answer : A

The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine

Last Answer : Answer : C

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain

Last Answer : Answer : B

Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond

Last Answer : Answer : B

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues

Last Answer : Answer : C

At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds

Last Answer : Answer : A

In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Description : In glycoproteins, carbohydrate residues are attached to which group of the polypeptide chain?

Last Answer : Hydroxyl group of serine or threonine.

A rectangular park has a concrete footpath running in the middle of the park parallel to the length of the park. The rest of the park is used as a playing ground, which has an area of 253 sq. m. If the width of the path is 4m and the length of the park is greater than its breadth by 8 m. What is the area of the park? (in sq. m.) (a) 896 (b) 345 (c) 432

Description : A rectangular park has a concrete footpath running in the middle of the park parallel to the length of the park. The rest of the park is used as a playing ground, which has an area of 253 sq. m. If the width of the path ... m. What is the area of the park? (in sq. m.) (a) 896 (b) 345 (c) 432

Last Answer : (b) 345

A rectangular plot has a concrete path running inner side of the plot is used as a lawn, which has an area of 432 sq.m. If the width of the path is 4 m and the length of the plot is greater than its breadth by 2m, what is the area of the rectangular plot? 1) 980 m^2 2) 975 m^2 3) 984 m^2 4) 960 m^2 5) 965 m^2

Description : A rectangular plot has a concrete path running inner side of the plot is used as a lawn, which has an area of 432 sq.m. If the width of the path is 4 m and the length of the plot is greater than its breadth by 2m, what is ... plot? 1) 980 m^2 2) 975 m^2 3) 984 m^2 4) 960 m^2 5) 965 m^2

Last Answer : 4) 960 m^2

Calorific value of proteins in a living person is less than that in a bomb calorimeter because (A) Digestion and absorption of proteins is less than 100% (B) Respiratory quotient of proteins is less than 1 (C) Specific dynamic action of proteins is high (D) Proteins are not completely oxidized in living persons

Description : Calorific value of proteins in a living person is less than that in a bomb calorimeter because (A) Digestion and absorption of proteins is less than 100% (B) Respiratory quotient of proteins ... Specific dynamic action of proteins is high (D) Proteins are not completely oxidized in living persons

Last Answer : Answer : D

A cuboid shaped wooden block has 6 cm length, 4 cm breadth and 1 cm height. 17. Two faces measuring 4 cm x 1 cm are coloured in black. 18. Two faces measuring 6 cm x 1 cm are coloured in red. 19. Two faces measuring 6 cm x 4 cm are coloured in green. 20. The block is divided into 6 equal cubes of side 1 cm (from 6 cm side), 4 equal cubes of side 1 cm(from 4 cm side). How many cubes will have green colour on two sides and rest of the four sides having no colour ? (a)12 (b)10 (c)8 (d)4

Description : A cuboid shaped wooden block has 6 cm length, 4 cm breadth and 1 cm height. 17. Two faces measuring 4 cm x 1 cm are coloured in black. 18. Two faces measuring 6 cm x 1 cm are coloured in red. 19. Two faces ... colour on two sides and rest of the four sides having no colour ? (a)12 (b)10 (c)8 (d)4

Last Answer : Answer key : (c)

For a ribbed slab (A) Clear spacing between ribs shall not be greater than 4.5 cm (B) Width of the rib shall not be less than 7.5 cm (C) Overall depth of the slab shall not exceed four times the breadth of the rib (D) All the above

Description : For a ribbed slab (A) Clear spacing between ribs shall not be greater than 4.5 cm (B) Width of the rib shall not be less than 7.5 cm (C) Overall depth of the slab shall not exceed four times the breadth of the rib (D) All the above

Last Answer : Answer: Option D

Pick out the wrong statement pertaining to the turbine agitator. (A) Recommended peripheral speed for the turbine agitator is 200-250 metres/minute (B) Pitched blade turbine agitator gives only radial flow with complete absence of the axial flow (C) Generally, the diameter of the agitator is kept between l/3rd to l/6th of the tank diameter while the blade length is l/4th of agitator diameter (with central disc, it is l/8th of the agitator diameter)

Description : Pick out the wrong statement pertaining to the turbine agitator. (A) Recommended peripheral speed for the turbine agitator is 200-250 metres/minute (B) Pitched blade turbine agitator gives only radial flow with ... l/4th of agitator diameter (with central disc, it is l/8th of the agitator diameter)

Last Answer : (B) Pitched blade turbine agitator gives only radial flow with complete absence of the axial flow

The specific speed of a centrifugal compressor is generally A. less than that of reciprocating compressor B. independent of compressor type, but depends only on size of compressor C. higher than that of axial compressor D. more than specific speed of reciprocating compressor but less than axial compressor

Description : The specific speed of a centrifugal compressor is generally A. less than that of reciprocating compressor B. independent of compressor type, but depends only on size of compressor C. higher ... axial compressor D. more than specific speed of reciprocating compressor but less than axial compressor

Last Answer : ANSWER : C

The area of a drainage basin whose axial length is 100 km is 2500 sq. km. Its form factor is (A) 0.10 (B) 0.20 (C) 0.25 (D) 0.35

Description : The area of a drainage basin whose axial length is 100 km is 2500 sq. km. Its form factor is (A) 0.10 (B) 0.20 (C) 0.25 (D) 0.35

Last Answer : Answer: Option C

Which of the following statements is incorrect? (a) Prions consist of abnormally folded proteins. (b) Viroids lack a protein coat. (c) Viruses are obligate parasites. (d) Infective constituent in viruses is the protein coat.

Description : Which of the following statements is incorrect? (a) Prions consist of abnormally folded proteins. (b) Viroids lack a protein coat. (c) Viruses are obligate parasites. (d) Infective constituent in viruses is the protein coat.

Last Answer : (d) Infective constituent in viruses is the protein coat.

What is the ratio of the length and breadth of the Indian National Flag

Description : What is the ratio of the length and breadth of the Indian National Flag

Last Answer : 0.12638888888889

A simply supported uniform rectangular bar breadth b, depth d and length L carries an isolated load W at its mid-span. The same bar experiences an extension e under same tensile load. The ratio of the maximum deflection to the elongation, is (A) L/d (B) L/2d (C) (L/2d)² (D) (L/3d)²

Description : A simply supported uniform rectangular bar breadth b, depth d and length L carries an isolated  load W at its mid-span. The same bar experiences an extension e under same tensile load. The  ratio of the maximum deflection to the ... (A) L/d (B) L/2d (C) (L/2d)² (D) (L/3d)²

Last Answer : (C) (L/2d)

The ratio of the length to breadth of a wooden float, is (A) 4.5 (B) 5.5 (C) 6.5 (D) 7.5

Description : The ratio of the length to breadth of a wooden float, is (A) 4.5 (B) 5.5 (C) 6.5 (D) 7.5

Last Answer : (D) 7.5

Which one of the following pairs of chemical substances, is correctly categorised? (a) Calcitonin and thymosin - Thyroid hormones (b) Pepsin and prolactin - Two digestive enzymes secreted in stomach (c) Troponin and myosin - Complex proteins in striated muscles (d) Secretin and rhodopsin - Polypeptide hormones

Description : Which one of the following pairs of chemical substances, is correctly categorised? (a) Calcitonin and thymosin - Thyroid hormones (b) Pepsin and prolactin - Two digestive enzymes secreted in ... and myosin - Complex proteins in striated muscles (d) Secretin and rhodopsin - Polypeptide hormones

Last Answer : (c) Troponin and myosin - Complex proteins in striated muscles

Find the lateral surface area and total surface area of a cuboid of length 80 cm, breadth 40 cm and height 20 cm. -Maths 9th

Description : Find the lateral surface area and total surface area of a cuboid of length 80 cm, breadth 40 cm and height 20 cm. -Maths 9th

Last Answer : Length of cuboid (l) = 80 cm Breadth (b) = 40 cm Height (h) = 20 cm (i) ∴ Lateral surface area = 2h(l + b) = 2 x 20(80 + 40) cm² = 40 x 120 = 4800 cm² (ii) Total surface area = 2(lb ... x 40 + 40 x 20 + 20 x 80) cm² = 2(3200 + 800 + 1600) cm² = 5600 x 2 = 11200 cm²

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Sickle cell anemia is caused a) When valine is replaced by glutamic acid in beta polypeptide chain b) When glutamic acid is replaced by valine in beta polypeptide chain c) When glutamic acid is replaced by valine in alpha polypeptide chain d) When valine is replaced by glutamic acid in alpha polypeptide chain

Description : Sickle cell anemia is caused a) When valine is replaced by glutamic acid in beta polypeptide chain b) When glutamic acid is replaced by valine in beta polypeptide chain c) When ... valine in alpha polypeptide chain d) When valine is replaced by glutamic acid in alpha polypeptide chain

Last Answer : b) When glutamic acid is replaced by valine in beta polypeptide chain

In rapid sand filters the ratio of length and diameter of the lateral, should not be greater than (A) 10 (B) 15 (C) 20 (D) 25

Description : In rapid sand filters the ratio of length and diameter of the lateral, should not be greater than (A) 10 (B) 15 (C) 20 (D) 25

Last Answer : (C) 20

Tortuosity of a meandering river is the ratio of (A) Meander belt to meander length (B) Meander length to meander belt (C) Curved length along the channel to the direct axial length of the river reach (D) Direct axial length of the river reach to curved length along the channel

Description : Tortuosity of a meandering river is the ratio of (A) Meander belt to meander length (B) Meander length to meander belt (C) Curved length along the channel to the direct axial length of the river reach (D) Direct axial length of the river reach to curved length along the channel

Last Answer : Answer: Option C

The maximum possible chain length of fatty acids formed in the pathway of de novo synthesis is (A) 16 Carbon atoms (B) 18 Carbon atoms (C) 20 Carbon atoms (D) 24 Carbon atoms

Description : The maximum possible chain length of fatty acids formed in the pathway of de novo synthesis is (A) 16 Carbon atoms (B) 18 Carbon atoms (C) 20 Carbon atoms (D) 24 Carbon atoms

Last Answer : Answer : A

The capacity of a cuboidal tank is 50000 litres of water. Find the breadth of the tank, if its length and depth are respectively 2.5 m and 10 m -Maths 9th

Description : The capacity of a cuboidal tank is 50000 litres of water. Find the breadth of the tank, if its length and depth are respectively 2.5 m and 10 m -Maths 9th

Last Answer : Length (l) and depth (h) of tank is 2.5 m and 10 m respectively. To find: The value of breadth, say b. Formula to find the volume of a tank = l b h = (2.5 b 10) m3= 25b m3 Capacity ... of water (Given) Therefore, 25000 b = 50000 This implies, b = 2 Therefore, the breadth of the tank is 2 m.

The diagonal of a rectangle is 10 units. The formula to find the diagonal is `d=sqrt(l^(2)+b^(2))`. Where l and b are length and breadth respectively.

Description : The diagonal of a rectangle is 10 units. The formula to find the diagonal is `d=sqrt(l^(2)+b^(2))`. Where l and b are length and breadth respectively.

Last Answer : The diagonal of a rectangle is 10 units. The formula to find the diagonal is `d=sqrt(l^(2)+b ... breadth respectively. (10+b)(10-b) is equal to______.

A cuboid shaped wooden block has 6 cm length, 4 cm breadth and 1 cm height. 12. Two faces measuring 4 cm x 1 cm are coloured in black. 13. Two faces measuring 6 cm x 1 cm are coloured in red. 14. Two faces measuring 6 cm x 4 cm are coloured in green. 15. The block is divided into 6 equal cubes of side 1 cm (from 6 cm side), 4 equal cubes of side 1 cm(from 4 cm side). How many cubes will have 4 coloured sides and two non-coloured sides ? (a)8 (b)4 (c)16 (d)10

Description : A cuboid shaped wooden block has 6 cm length, 4 cm breadth and 1 cm height. 12. Two faces measuring 4 cm x 1 cm are coloured in black. 13. Two faces measuring 6 cm x 1 cm are coloured in red. 14. Two ... How many cubes will have 4 coloured sides and two non-coloured sides ? (a)8 (b)4 (c)16 (d)10

Last Answer : Answer key : (b)

A cuboid shaped wooden block has 6 cm length, 4 cm breadth and 1 cm height. 7. Two faces measuring 4 cm x 1 cm are coloured in black. 8. Two faces measuring 6 cm x 1 cm are coloured in red. 9. Two faces measuring 6 cm x 4 cm are coloured in green. 10. The block is divided into 6 equal cubes of side 1 cm (from 6 cm side), 4 equal cubes of side 1 cm(from 4 cm side). How many small cubes will be formed? (a)6 (b)12 (c)16 (d)24

Description : A cuboid shaped wooden block has 6 cm length, 4 cm breadth and 1 cm height. 7. Two faces measuring 4 cm x 1 cm are coloured in black. 8. Two faces measuring 6 cm x 1 cm are coloured in red. 9. Two faces measuring ... 1 cm(from 4 cm side). How many small cubes will be formed? (a)6 (b)12 (c)16 (d)24

Last Answer : Answer key : (d)

Why the work per kg of air flow in axial flow compressor is less compared to centrifugal compressor for same pressure ratio ?

Description : Why the work per kg of air flow in axial flow compressor is less compared to centrifugal compressor for same pressure ratio ?

Last Answer : Isentropic efficiency of axial flow compressor is higher.