Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours
Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis
Description : What type organic macro molecule is form polymerization reaction between amino acids?
Last Answer : This macromolecule is a protein.
Description : What type organic macro-molecule is form polymerization reaction between amino acids?
Description : Which of the following statement(s) is/are true concerning the proliferative phase of wound healing? a. The macrophage is the predominant cell type b. The pink or purple-red appearance of a wound ... amino acids, hydroxyproline and hydroxylysine d. The predominant collagen type in a scar is type 3
Last Answer : Answer: b, c The proliferative phase of wound healing begins with the formation of a provisional matrix of fibrin and fibronectin as part of the initial clot formation. Initially, the provisional ... The principal collagen type scar is type 1, with lesser amounts of type 3 collagen also present
Description : The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?
Last Answer : beads of different colors joined together on a piece of string
Description : In the B chain of insulin molecule, the C-terminal amino acid: (A) Threonine (B) Tyrosine (C) Glutamate (D) Valine
Last Answer : Answer : A
Description : In the B chain of insulin molecule, the Nterminal amino acid is (A) Proline (B) Threonine (C) Phenylalanine (D) Lysine
Last Answer : Answer : C
Description : In the A chain of insulin molecule the Cterminal amino acid is (A) Asparagine (B) Threonine (C) Valine (D) Tyrosine
Description : In A chain of the insulin molecule the Nterminal amino acid is (A) Glycine (B) Valine (C) Serine (D) Phenylalanine
Description : Degeneracy of genetic code implies that (A) Codons do not code for specific amino acid (B) Multiple codons must decode the same amino acids (C) No anticodon on tRNA molecule (D) Specific codon decodes many amino acids
Last Answer : Answer : B
Description : From two amino acids peptide bond formation involves removal of one molecule of (A) Water (B) Ammonia (C) Carbondioxide (D) Carboxylic acid
Description : In one molecule of albumin the number of amino acids is (A) 510 (B) 590 (C) 610 (D) 650
Description : All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons
Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin
Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
Description : Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38
Description : The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain
Description : Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain
Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine
Last Answer : Answer : D
Description : The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements
Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids
Description : All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine
Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
Last Answer : Ans. ((b))
Description : Which of the following statement(s) is/are true concerning the treatment of MOFS? a. Prevention and therapy of MOFS requires control of the infectious or inflammatory source b. Restoration of normal ... of the nature of gut injury, total parenteral nutrition is preferred for most patients with MOFS
Last Answer : Answer: a, c The therapy of MOFS is directed towards interrupting the involving pathophysiologic process and providing an optimal physiologic environment for healing and recovery. ... Enteral absorption and processing of nutrients appears superior to TPN and lessens overall complications
Description : A modified amino acid solution with increased equimolar branched-chain amino acids and decreased aromatic amino acids has been proposed for patients with hepatic insufficiency. Which of the following ... D. In some studies of surgical patients, improvements in mortality have been reported.
Last Answer : Answer: D DISCUSSION: The use of modified amino acid solutions is based on the false neurotransmitter hypothesis of the cause of hepatic coma. According to this hypothesis, the imbalance ... in a group of patients with cirrhosis, decreasing morbidity and showing a trend toward decreased mortality
Description : What are branched chain amino acids?
Last Answer : Valine, leucine and isoleucine.
Description : Which of the following is the quaternary structure of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with ... (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone
Last Answer : description of the way the peptide chains are arranged with respect to each other
Description : Site in the ribosome from which the tRNA donates amino acids to the growing polypeptide chain is A- P site B- O site C- T site D- A site
Last Answer : P site
Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four
Last Answer : Three
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
Description : What are made from simpler molecules called amino acids?
Last Answer : Proteins
Description : Gastrin is a polypeptide made up of (A) Five amino acids (B) Twelve amino acids (C) Seventeen amino acids (D) Twenty amino acids
Description : CRH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Description : ACTH is a polypeptide made up of (A) 39 amino acids (B) 41 amino acids (C) 51 amino acids (D) 84 amino acids
Description : All the following statements about proopiomelanocortin are true except (A) It is made up of 285 amino acids (B) It is synthesised in pars intermedia and anterior lobe of pituitary gland ... ) It is the precursor of corticotropin like intermediate lobe peptide and endorphins 218 MCQs IN BIOCHEMISTRY
Description : Sulphur is made available to the body by the amino acids: (A) Cystine and methionine (B) Taurine and alanine (C) Proline and hydroxyproline (D) Arginine and lysine MINERAL METABOLISM 191
Description : Secretin is made up of (A) 17 amino acids (B) 27 amino acids (C) 37 amino acids (D) 47 amino acids
Description : Glutathione is made up of which amino acids?
Last Answer : Glutamic acid, cysteine and glycine.
Description : All enzymes are made of (A) Fats (B) Carbohydrates (C) Proteins (D) Amino acids
Last Answer : (C) Proteins
Description : Digestion of protein-is necessary because (a)It not absorbed as such (b)Proteins are large molecules. (c) Proteins have complex structure. (d) Proteins are made of amino acids
Last Answer : (a)It not absorbed as such
Description : A person who is on a long hunger strike and is surviving only on water, will have (a) less amino acids in his urine (b) more glucose in his blood (c) less urea in his urine (d) more sodium in his urine.
Last Answer : (c) less urea in his urine
Description : The acetyl CoA formed on β-oxidation of all long chain fatty acids is metabolized under normal circumstances to (A) CO2 and water (B) Cholesterol (C) Fatty acids (D) Ketone bodies
Description : All long chain fatty acids with even number of carbon atoms are oxidized to a pool of _________ by β-oxidation. (A) CO2 (B) Propionic acid (C) Acetic acid (D) Acetyl CoA
Description : A soluble system for synthesis of fatty acids have been isolated from avian liver, required for the formation of long chain fatty acids by this system is (A) ATP (B) Acetyl CoA (C) NADPH (D) All of these
Description : For the activation of long chain fatty acids the enzyme thiokinase requires the cofactor: (A) Mg++ (B) Ca++ (C) Mn++ (D) K+
Description : Long chain fatty acids are first activated to acyl CoA in the (A) Cytosol (B) Mitochodria (C) Ribosomes (D) Microsome
Description : All of the following statements about hypoglycin are true except (A) It is a plant toxin (B) It causes hypoglycaemia (C) It inhibits oxidation of short chain fatty acids (D) It inhibits oxidation of long chain fatty acids
Description : Mitochondrial membrane is permeable to (A) Short chain fatty acids (B) Medium chain fatty acids (C) Long chain fatty acids (D) All of these