The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?

The primary structure of a protein refers to the sequence of amino acids that are linked together in a long chain. Which of the following common items would best represent the primary structure of a protein?
by

1 Answer

Answer :

beads of different colors joined together on a piece of string
by

Related questions

The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix

Last Answer : the amino acid sequence in the polypeptide chain

Which of the following is the “quaternary structure” of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with respect to each other (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Description : Which of the following is the quaternary structure of proteins concerned with? (a) sequence of amino acids in the peptide chain (b) description of the way the peptide chains are arranged with ... (c) location of the disulfide bridges in the peptide chain (d) conformation of the protein backbone

Last Answer : description of the way the peptide chains are arranged with respect to each other

The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Description : The _______ structure of a protein is the sequence of amino acids. a. primary b. secondary c. tertiary d. quaternary

Last Answer : a. primary

Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges in the protein (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Description : Which of the following is the first step in the determination of the primary structure of proteins? (a) determining the number and kind of amino acids in the peptide (b) reducing the disulfide bridges ... (c) protecting the N-terminal of the peptide (d) protecting the C-terminal of the peptide

Last Answer : reducing the disulfide bridges in the protein

What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Description : What happens at the ribosome in the production of a protein? a. mRNA brings the codon b. tRNA brings the anticodon c. the amino acids are linked by polypeptide bonds d. translation e. all the above

Last Answer : c. the amino acids are linked by polypeptide bonds

What Portion of DNA which carries the genetic code for the formation of a particular protein by specifying its amino acids sequence?

Description : What Portion of DNA which carries the genetic code for the formation of a particular protein by specifying its amino acids sequence?

Last Answer : Gene

Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them with specific amino acids b. Covalent attachment of tRNA to amino acids is energy dependent c. The formation of a peptide bond between the growing peptide chain and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Description : Which of the following statement(s) is/are true concerning translation of the mRNA message to protein synthesis? a. An adaptor molecule, tRNA, recognizes specific nucleic acid bases and unites them ... and the free amino acid occurs in the free cytoplasm d. Complete protein synthesis takes hours

Last Answer : Answer: a, b The synthesis of protein involves conversion from a four-letter nucleotide language to one of 20 chemically distinct amino acids. This process is referred to as ... translation and be moving down the mRNA molecules simultaneously, thus increasing the rate of protein synthesis

Which of the following statement(s) is/are true concerning protein/amino acid metabolism in man? a. The major source of amino acids is breakdown of circulating proteins b. The recommended daily allowance for protein may triple in critically ill patients c. Urinary nitrogen losses will approach 0 in the face of protein starvation d. Negative nitrogen balance refers to a decrease in nitrogen taken into the body versus the amount of nitrogen lost

Description : Which of the following statement(s) is/are true concerning protein/amino acid metabolism in man? a. The major source of amino acids is breakdown of circulating proteins b. The recommended daily ... balance refers to a decrease in nitrogen taken into the body versus the amount of nitrogen lost

Last Answer : Answer: b, d About 15% of the total body weight is made up of proteins, about half of which are intracellular and half extracellular. In man and other animals, dietary protein is the source of ... is exceeded by the amount of nitrogen lost in the urine, stool, skin, wounds, and fistula drainage

What is the name of the bond that joins amino acids together in a protein?

Description : What is the name of the bond that joins amino acids together in a protein?

Last Answer : ANSWER: PEPTIDE BOND or AMIDE

What level of protein structure is affected by substituting charged amino acids with non polar ones?

Description : What level of protein structure is affected by substituting charged amino acids with non polar ones?

Last Answer : Feel Free to Answer

Tertiary structure of a protein describes (A) The order of amino acids (B) Location of disulphide bonds (C) Loop regions of proteins (D) The ways of protein folding

Description : Tertiary structure of a protein describes (A) The order of amino acids (B) Location of disulphide bonds (C) Loop regions of proteins (D) The ways of protein folding

Last Answer : Answer : D

Digestion of protein-is necessary because (a)It not absorbed as such (b)Proteins are large molecules. (c) Proteins have complex structure. (d) Proteins are made of amino acids

Description : Digestion of protein-is necessary because (a)It not absorbed as such (b)Proteins are large molecules. (c) Proteins have complex structure. (d) Proteins are made of amino acids

Last Answer : (a)It not absorbed as such

. In a linear polymer, the monomeric units are linked together to form long straight chains. The cross linked or branched chain polymers compared to linear polymers have higher (A) Densities (B) Melting point (C) Tensile strength (D) Hardness, rigidity & brittleness

Description : . In a linear polymer, the monomeric units are linked together to form long straight chains. The cross linked or branched chain polymers compared to linear polymers have higher (A) Densities (B) Melting point (C) Tensile strength (D) Hardness, rigidity & brittleness

Last Answer : (D) Hardness, rigidity & brittleness

Pick out the wrong statement. (A) Linear polymers are formed from bifunctional groups only and are normally thermoplastic (B) Cross-linked branched chain polymers are either elastometric or thermosetting (C) Branching in case of cross-linked polymers caused by small amount of impurities in bifunctional monomer formulation reduces its solubility and increases the softening point (D) Dibasic acids reacts with dihydric alcohols to give polyesters using addition polymerisation reaction

Description : Pick out the wrong statement. (A) Linear polymers are formed from bifunctional groups only and are normally thermoplastic (B) Cross-linked branched chain polymers are either elastometric or ... (D) Dibasic acids reacts with dihydric alcohols to give polyesters using addition polymerisation reaction

Last Answer : D) Dibasic acids reacts with dihydric alcohols to give polyesters using addition polymerisation reaction

Denaturation refers to the loss of the ______ structure of a ______ molecule. a. primary; carbohydrate b. molecular; fat c. secondary; starch d. tertiary; protein

Description : Denaturation refers to the loss of the ______ structure of a ______ molecule. a. primary; carbohydrate b. molecular; fat c. secondary; starch d. tertiary; protein

Last Answer : d. tertiary; protein

is called for the diagram that shows how food chain linked together into more complex feeding relationship. a) Food web c) Food circle b) Food chain d) Food triangle

Description : is called for the diagram that shows how food chain linked together into more complex feeding relationship. a) Food web c) Food circle b) Food chain d) Food triangle

Last Answer : FOOD WEB

What type of molecule is made from a long chain of amino acids?

Description : What type of molecule is made from a long chain of amino acids?

Last Answer : protein

Neoprene is rendered non-inflammable, because of (A) Its cross-linked structure (B) Its linear chain structure (C) The presence of chlorine atoms in its monomer (D) The absence of chlorine atoms in its monomer

Description : Neoprene is rendered non-inflammable, because of (A) Its cross-linked structure (B) Its linear chain structure (C) The presence of chlorine atoms in its monomer (D) The absence of chlorine atoms in its monomer

Last Answer : (C) The presence of chlorine atoms in its monomer

Which one of the following items gives its correct total number? (a) Types of diabetes-3 (b) Cervical vertebrae in humans-8 (c) Floating ribs in humans-4 (d) Amino acids found in proteins-16

Description : Which one of the following items gives its correct total number? (a) Types of diabetes-3 (b) Cervical vertebrae in humans-8 (c) Floating ribs in humans-4 (d) Amino acids found in proteins-16

Last Answer : (c) Floating ribs in humans-4

How many amino acids are coded for by this sequence of nucleotides?

Description : How many amino acids are coded for by this sequence of nucleotides?

Last Answer : Need answer

What sequence of amino acids will correspond to this set of nucleotides AUGCCUACGUGGAC?

Description : What sequence of amino acids will correspond to this set of nucleotides AUGCCUACGUGGAC?

Last Answer : What is the answer ?

The sequence of amino acids in human growth hormone and the synthesis were done by (A) Sanger (B) Krebs (C) Chah Holi (D) Molisch

Description : The sequence of amino acids in human growth hormone and the synthesis were done by (A) Sanger (B) Krebs (C) Chah Holi (D) Molisch

Last Answer : Answer : C

In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Description : In the regulation of genes: a. more than 90% of the base sequences in human DNA have not known function b. extrons are the part of the gene that code for amino acids found in the final proteins. c. introns usually begins with the nucleotide sequence GT d. all above

Last Answer : all above

Amniocentesis is a method for : (1) determination of foetal health conditions (2) determination of the amino acids sequence (3) inducing abortion (4) artificial insemination

Description : Amniocentesis is a method for : (1) determination of foetal health conditions (2) determination of the amino acids sequence (3) inducing abortion (4) artificial insemination

Last Answer : determination of foetal health conditions

All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons

Description : All of the following statements about nonsense codons are true except (A) They do not code for amino acids (B) They act as chain termination signals (C) They are identical in nuclear and mitochondrial DNA (D) They have no complementary anticodons

Last Answer : Answer : C

__________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin

Last Answer : Answer : C

The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39

Last Answer : Answer : B

Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38

Description : Insulin is a dimmer. The number of amino acids in the A and B chain respectively is (A) 19 and 28 (B) 21 and 30 (C) 25 and 35 (D) 29 and 38

Last Answer : Answer : B

The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the human has an impaired ability to synthesize the carbon chain of the corresponding ketoacids (C) are identical in all species studied (D) are defined as these amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Description : The essential amino acids (A) must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Last Answer : Answer : B

Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain

Description : Abnormal chain of amino acids in sickle cell anaemia is (A) Alpha chain (B) Beta chain (C) Delta chain (D) Gama chain

Last Answer : Answer : B

Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain

Description : Abnormal chain of amino acids in sickle cells anaemia is (A) Alpha chain (B) Beta chain (C) Gama chain (D) Delta chain

Last Answer : Answer : B

Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine

Description : Branched chain amino acids are (A) Cysteine and cystine (B) Tyrosine and Tryptophan (C) Glycine and Serine (D) Valine, Leucine and Isoleucine

Last Answer : Answer : D

The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the human has an impaired ability to synthesize the carbon chain of the corresponding ketoacids (C) Are identical in all species studied (D) Are defined as those amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Description : The essential amino acids (A) Must be supplied in the diet because the organism has lost the capacity to aminate the corresponding ketoacids (B) Must be supplied in the diet because the ... amino acids which cannot be synthesized by the organism at a rate adequate to meet metabolic requirements

Last Answer : Answer : B

Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids

Description : Maple syrup urine diseases is an inborn error of metabolism of (A) Sulphur-containing amino acids (B) Aromatic amino acids (C) Branched chain amino acids (D) Dicarboxylic amino acids

Last Answer : Answer : C

All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine

Description : All the following are branched chain amino acids except (A) Isoleucine (B) Alanine (C) Leucine (D) Valine

Last Answer : Answer : B

A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain

Last Answer : Ans. ((b))

Which of the following statement(s) is/are true concerning the treatment of MOFS? a. Prevention and therapy of MOFS requires control of the infectious or inflammatory source b. Restoration of normal clinical parameters such as blood pressure, pulse rate, and urine output ensures optimal resuscitation in most patients c. Branch chain amino acids play and important role in the nutritional support of the patient d. Because of the nature of gut injury, total parenteral nutrition is preferred for most patients with MOFS

Description : Which of the following statement(s) is/are true concerning the treatment of MOFS? a. Prevention and therapy of MOFS requires control of the infectious or inflammatory source b. Restoration of normal ... of the nature of gut injury, total parenteral nutrition is preferred for most patients with MOFS

Last Answer : Answer: a, c The therapy of MOFS is directed towards interrupting the involving pathophysiologic process and providing an optimal physiologic environment for healing and recovery. ... Enteral absorption and processing of nutrients appears superior to TPN and lessens overall complications

A modified amino acid solution with increased equimolar branched-chain amino acids and decreased aromatic amino acids has been proposed for patients with hepatic insufficiency. Which of the following statements is/are true? A. This formulation is proposed for the use of patients with fulminant hepatitis. B. Nitrogen balance is achieved in such patients with amounts of 40 gm. of amino acids per 24 hours. C. The use of 80 to 100 gm. of such solutions is associated with hepatic encephalopathy. D. In some studies of surgical patients, improvements in mortality have been reported.

Description : A modified amino acid solution with increased equimolar branched-chain amino acids and decreased aromatic amino acids has been proposed for patients with hepatic insufficiency. Which of the following ... D. In some studies of surgical patients, improvements in mortality have been reported.

Last Answer : Answer: D DISCUSSION: The use of modified amino acid solutions is based on the false neurotransmitter hypothesis of the cause of hepatic coma. According to this hypothesis, the imbalance ... in a group of patients with cirrhosis, decreasing morbidity and showing a trend toward decreased mortality

What are branched chain amino acids?

Description : What are branched chain amino acids?

Last Answer : Valine, leucine and isoleucine.

Site in the ribosome from which the tRNA donates amino acids to the growingpolypeptide chain is A- P site B- O site C- T site D- A site

Description : Site in the ribosome from which the tRNA donates amino acids to the growing polypeptide chain is A- P site B- O site C- T site D- A site

Last Answer : P site

What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four

Last Answer : Three

hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG

Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA

Which of the following statements best describes the structure of waxes? (a) long-chain unsaturated carboxylic acids (b) long-chain saturated carboxylic acids (c) long-chain esters (d) short-chain esters

Description : Which of the following statements best describes the structure of waxes? (a) long-chain unsaturated carboxylic acids (b) long-chain saturated carboxylic acids (c) long-chain esters (d) short-chain esters

Last Answer : long-chain esters

Insertion of a base in a gene can cause (A) Change in reading frame (B) Garbled amino acid sequence in the encoded protein (C) Premature termination of translation (D) All of these

Description : Insertion of a base in a gene can cause (A) Change in reading frame (B) Garbled amino acid sequence in the encoded protein (C) Premature termination of translation (D) All of these

Last Answer : Answer : D

Amino acid sequence of the encoded protein is not changed in (A) Silent mutation (B) Acceptable mis-sense mutation (C) Both (A) and (B) (D) None of these

Description : Amino acid sequence of the encoded protein is not changed in (A) Silent mutation (B) Acceptable mis-sense mutation (C) Both (A) and (B) (D) None of these

Last Answer : Answer : A

The half-life of a protein depends upon its (A) Signal sequence (B) N-terminus amino acid (C) C-terminus amino acid (D) Prosthetic group

Description : The half-life of a protein depends upon its (A) Signal sequence (B) N-terminus amino acid (C) C-terminus amino acid (D) Prosthetic group

Last Answer : Answer : B

Edman’s reaction can be used to (A) Determine the number of tyrosine residues in a protein (B) Determine the number of aromatic amino acid residues in a protein (C) Determine the amino acid sequence of a protein (D) Hydrolyse the peptide bonds in a protein

Description : Edman’s reaction can be used to (A) Determine the number of tyrosine residues in a protein (B) Determine the number of aromatic amino acid residues in a protein (C) Determine the amino acid sequence of a protein (D) Hydrolyse the peptide bonds in a protein

Last Answer : Answer : C

Amino acid sequence directs protein folding?

Description : Insulin possesses two polypeptide chains denoted A and B that are linked by disulfide bonds. Upon denaturation by reduction of the SH groups of insulin, followed by reoxidation, only 7% of the ... can these data be reconciled with the hypothesis that the amino acid sequence directs protein folding?

Last Answer : Insulin is synthesized as preproinsulin that is proteolytically processed in the β cells of the islets of Langerhans in the pancreas, to give proinsulin. After synthesis and folding, a section of the ... lacking the C peptide, lacks some of the information necessary to direct the folding process. 

Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (b) tRNA

.Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Description : .Amino acid sequence, in protein synthesis is decided by the sequence of (a) rRNA (b) tRNA (c) mRNA (d) cDNA.

Last Answer : (c) mRNA