Description : Insulin is made up of (A) A single polypeptide chain having 51 amino acid residues (B) A single polypeptide chain having 84 amino acid residues (C) A-chain having 21 and B-chain having 30 amino acid residues (D) A-chain having 30 and B-chain having 21 amino acid residues
Last Answer : Answer : C
Description : Glycoproteins are marked for destruction by removal of their (A) Oligosaccharide prosthetic group (B) Sialic acid residues (C) Mannose residues (D) N-terminal amino acids
Last Answer : Answer : D
Description : Collagen and elastin have the following similarity: (A) Both are triple helices (B) Both have hydroxyproline residues (C) Both have hydrolysine residues (D) Both are glycoproteins
Last Answer : Answer : A
Description : In glycoproteins the carbohydrate is in the form of disaccharide units, the number of units are (A) 50–100 (B) 200–300 (C) 400–500 (D) 600–700
Description : In N-linked glycoproteins, oligosaccharide is attached to protein through its (A) Asparagine residue (B) Glutamine residue (C) Arginine residue (D) Lysine residue
Description : for dental caries to progress in dentine, A. the dentine must contain soluble collagen B. enamel must contain glycoproteins C. diet must contain simple carbohydrate D. diet must contain polysaccharides E. pulp must contain complement
Last Answer : C. diet must contain simple carbohydrate
Description : Extracellular polysaccharides in plaque are formed by: A. Bacteria from sucrose B. Precipitated from carbohydrate C. Precipitated from glycoproteins
Last Answer : A. Bacteria from sucrose
Description : For dental caries to progress in dentine, A. The dentine must contain soluble collagen B. Enamel must contain glycoproteins C. Diet must contain simple carbohydrate D. Diet must contain polysaccharides E. Pulp must contain complement
Last Answer : C. Diet must contain simple carbohydrate
Description : In prokaryotes, chloramphenicol (A) Causes premature release of the polypeptide chain (B) Causes misreading of the mRNA (C) Depolymerises DNA (D) Inhibits peptidyl transferase activity
Description : The amino terminal of all polypeptide chain at the time of synthesis in E. coli is tagged to the amino acid residue: (A) Methionine (B) Serine (C) N-formyl methinine(D) N-formal serine
Description : __________ hormone is a single chain polypeptide having 32 amino acids with molecular weight of 3,600. (A) Testosteron (B) Thyroxine (C) Calcitonine (D) Vasopressin
Description : All the following statements about epidermal growth factor are true except (A) It is a protein (B) It possess quaternary structure (C) Its receptor is made up of a single polypeptide chain (D) Its receptor possesses tyrosine kinase domain
Last Answer : Answer : B
Description : Human growth hormone has (A) One polypeptide chain and one intra-chain disulphide bond (B) One polypeptide chain and two intra-chain disulphide bond (C) Two polypeptide chains joined by one disulphide bond (D) Two polypeptide chains joined by two disulphide bond
Description : The number of amino acids in single chain polypeptide glucagons is (A) 21 (B) 29 (C) 31 (D) 39
Description : At the lowest energy level α-helix of polypeptide chain is stabilised (A) By hydrogen bonds formed between the H of peptide N and the carbonyl O of the residue (B) Disulphide bonds (C) Non polar bonds (D) Ester bonds
Description : Globular proteins have completely folded, coiled polypeptide chain and the axial ratio (ratio of length to breadth) is (A) Less than 10 and generally not greater than 3–4 (B) Generally 10 (C) Greater than 10 and generally 20 (D) Greater than 10
Description : A complex of ribosomes attached to a single strand of RNA is known as (a) polypeptide (b) Okazaki fragment (c) polysome (d) polymer.
Last Answer : (b) Okazaki fragment
Description : .A complex of ribosomes attached to a single strand of RNA is known as (a) polypeptide (b) Okazaki fragment (c) polysome (d) polymer
Last Answer : (c) polysome
Description : DDT residues are rapidly passed through food chain causing biomagnification because DDT is
Last Answer : DDT residues are rapidly passed through food chain causing biomagnification because DDT is A. Water ... C. Liposoluble D. Nontoxic to aquatic animals
Last Answer : DDT residues are rapidly passed through food chain causing biomagnification because DDT is A. Water ... toxic D. Non-toxic to aquatic animals
Description : DDT residues are rapidly passed through food chain causing biomagnification because DDT is (a) moderately toxic (b) non-toxic to aquatic animals (c) water soluble (d) lipo soluble.
Last Answer : (d) lipo soluble.
Description : The designation D or Lbefore the name of a monosaccharide (a) indicates the direction of rotation of polarized light. (b) indicates the length of the carbon chain in the carbohydrate. (c) ... the primary alcohol group. (d) indicates the position of the asymmetric carbon atoms in the carbohydrate.
Last Answer : indicates the position of the OH group on the carbon next to the primary alcohol group.
Description : The carbon atom wh ich becomes asymmetric when the straight chain form of monosaccharide changes into ring form is known as CARBOHYDRATES AND CARBOHYDRATE METABOLISM 9 (A) Anomeric carbon atom (B) Epimeric carbon atom (C) Isomeric carbon atom (D) None of these
Last Answer : A
Description : A chain of amino acids joined by peptide bonds is called as (a) Peptide chain (b) Polypeptide chain (c) Polyamino acid chain (d) Nucleotide chain
Last Answer : Ans. ((b))
Description : The primary structure of a protein refers to : (a) whether the protein is fibrous or globular (b) the amino acid sequence in the polypeptide chain (c) the orientation of the amino acid side chains in space (d) the presence or absence of an α-helix
Last Answer : the amino acid sequence in the polypeptide chain
Description : What is the maximum number of different amino acids in a polypeptide chain coded by the synthetic polyribonucleotides (UCAG)5? A- One B- Two C- Three D- Four
Last Answer : Three
Description : hich mRNA will be translated to a polypeptide chain containing 8 amino acids? a) AUGUUAAUAGACGAGUAGCGACGAUGU b) AUGAGACGGACUGCAUUCCCAACCUGA c) AUGCCCAACCGUUAUUCAUGCUAG d) AUGUCGACAGUCUAAAACAGCGGG
Last Answer : b) AUGAGACGGACUGCAUUCCCAACCUGA
Description : Sickle cell anemia is caused a) When valine is replaced by glutamic acid in beta polypeptide chain b) When glutamic acid is replaced by valine in beta polypeptide chain c) When ... valine in alpha polypeptide chain d) When valine is replaced by glutamic acid in alpha polypeptide chain
Last Answer : b) When glutamic acid is replaced by valine in beta polypeptide chain
Description : Which of the following component of respiratory chain is not attached to the inner mitochondrial membrane? (A) Coenzyme Q (B) Cytochrome c (C) Both (A) and (B) (D) None of these
Description : Retinoic acid is involved in the synthesis of (A) Rhodopsin (B) Iodopsin (C) Porphyrinopsin (D) Glycoproteins
Description : Retinal is a component of (A) Iodopsin (B) Rhodopsin (C) Cardiolipin (D) Glycoproteins
Description : Oligosaccharide-pyrophosphoryl dolichol is required for the synthesis of (A) N-linked glycoproteins (B) O-linked glycoproteins (C) GPI-linked glycoproteins (D) All of these
Description : Proteins that carries Iron into different tissues is (A) Ceruloplasmin (B) Trans cortin (C) Mucoproteins (D) Glycoproteins
Description : Transcortins are (A) Mucoproteins (B) Glycoproteins (C) Metalloproteins (D) Lipoproteins
Description : Sialic acids are present in (A) Proteoglycans (B) Glycoproteins (C) Both (A) and (B) (D) None of these
Description : All of the following are glycoproteins except (A) Collagen (B) Albumin (C) Transferrin (D) IgM
Description : Plasma proteins which contain more than 4% hexosamine are (A) Microglobulins (B) Glycoproteins (C) Mucoproteins (D) Orosomucoids
Description : The Golgi complex (A) Synthesizes proteins (B) Produces ATP (C) Provides a pathway for transporting chemicals (D) Forms glycoproteins
Last Answer : D
Description : In a refinery petroleum crude is fractionated into gas fraction, light ends, intermediate distillates, heavy distillates, residues and by products. The group of products including gas oil, diesel oil and ... the fraction (A) Heavy distillates (B) Intermediate distillates (C) Light ends (D) Residues
Last Answer : (A) Heavy distillates
Description : Buffering action of haemoglobin is mainly due to its (A) Glutamine residues (B) Arginine residues (C) Histidine residues (D) Lysine residues
Description : Blue print for genetic information residues in (A) mRNA (B) tRNA (C) rRNA (D) DNA
Description : Zinc finger motif is formed in some proteins by binding of zinc to (A) Two cysteine residues (B) Two histidine residues (C) Two arginine residues (D) Two cysteine and two histidine residues or two pairs of two cysteine residues each
Description : Leucine zipper motif is seen in some helical proteins when leucine residues appear at every (A) 3rd position (B) 5th position (C) 7th position (D) 9th position
Description : Number of guanine and cytosine residues is equal in (A) mRNA (B) tRNA (C) DNA (D) None of these
Description : Ultraviolet light can damage a DNA strand causing (A) Two adjacent purine residue to form a covalently bounded dimer (B) Two adjacent pyrimidine residues to form covalently bonded dimer (C) Disruption of phosphodiesterase linkage (D) Disruption of non-covalent linkage
Description : Number of amino acid residues in glucagons is (A) 29 (B) 34 (C) 51 (D) 84
Description : Amino acid residues which are essential for the biological activity of PTH are (A) N-terminal 34 amino acids (B) N-terminal 50 amino acids (C) C-terminal 34 amino acids (D) C-terminal 50 amino acids
Description : The number of amino acid residues in PTH: (A) 51 (B) 84 (C) 90 (D) 115
Description : In thyroxine, tyrosine residues are iodinated at positions: (A) 1 and 3 (B) 2 and 4 (C) 3 and 5 (D) 4 and 6